xseA
168
similar to exodeoxyribonuclease VII (large subunit)
locus
BSU_24300
Molecular weight
50.85 kDa
pI
9.55
function
unknown
product
unknown
essential
no
synonyms
yqiB
Outlinks
Genomic Context
Categories containing this gene/protein
List of homologs in different organisms, belongs to COG1570 (Galperin et al., 2021)
This gene is a member of the following regulons
Gene
Coordinates
2,526,920 → 2,528,266
The protein
Catalyzed reaction/ biological activity
Exonucleolytic cleavage in either 5'- to 3'- or 3'- to 5'-direction to yield nucleoside 5'-phosphates (according to UniProt)
Protein family
xseA family (single member, according to UniProt)
Structure
[AF|P54521]
[wiki|Localization]
cytoplasm (according to Swiss-Prot), Cytoplasm (Homogeneous) [Pubmed|16479537]
Biological materials
Mutant
BKE24300 (Δ[gene|D9DCD38A0BCDEE2EF6A19A2CC13A3A0ACB216C37|xseA]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE24300 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCTAAAAACTCCTCTC, downstream forward: _UP4_TTAGAAAAGAGAGGGGAAGA
BKK24300 (Δ[gene|D9DCD38A0BCDEE2EF6A19A2CC13A3A0ACB216C37|xseA]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK24300 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCTAAAAACTCCTCTC, downstream forward: _UP4_TTAGAAAAGAGAGGGGAAGA
References
Page visits: 2584
Time of last update: 2025-10-26 07:33:13
Author of last update: WMallard