yppC
168
unknown
locus
BSU_22300
Molecular weight
38.38 kDa
pI
10.31
function
unknown
product
unknown
essential
no
ec
null
synonyms
yppC, jopC
Outlinks
Genomic Context
Categories containing this gene/protein
List of homologs in different organisms
This gene is a member of the following regulons
Gene
Coordinates
2,339,799 → 2,340,761
The protein
Structure
[AF|P39791]
[wiki|Localization]
spore core (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|C690DCDD98686DAF292B9D280B9948640ED75F24|yppC]
description
[Pubmed|22383849]
Biological materials
Mutant
MGNA-A475 (yppB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/475 NBRP B. subtilis, Japan]
BKE22300 (Δ[gene|C690DCDD98686DAF292B9D280B9948640ED75F24|yppC]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE22300 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCACTTCCGTCATGATT, downstream forward: _UP4_TAAAGAAGCAAGGAAATTCC
BKK22300 (Δ[gene|C690DCDD98686DAF292B9D280B9948640ED75F24|yppC]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK22300 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCACTTCCGTCATGATT, downstream forward: _UP4_TAAAGAAGCAAGGAAATTCC
Page visits: 2534
Time of last update: 2025-10-25 21:15:03
Author of last update: Bzhu