fenA

168

magnesium-dependent 5'->3' flap endonuclease, major contributor to the removal of RNA from an Okazaki fragment, protection of developing and dormant spores against UV DNA damage

locus: BSU_22010

Molecular weight: 32.79 kDa

pI: 5.22

Protein length: 296 aa

Gene length: 888 bp

function: removal of RNA from Okazaki fragments

product: 5′-3′ flap endonuclease

essential: no

synonyms: exoR, ypcP, exoA

List of homologs in different organisms, belongs to COG0258 (Galperin et al., 2021)

Gene

Coordinates: 2,310,995 → 2,311,885

Phenotypes of a mutant

• a [gene|3D6DA8B52A4CB49361E67906140696FFA1EF6099|polA] [gene|FCDE5EA6E50A8C72A499E2F1FFB808DC86466A29|fenA] double mutant is not viable (synthetic lethality) [pubmed|17114254]
• a [gene|B8B0F6B129475FDEEA8D538A51C153BF9A35887D|rnhC] [gene|FCDE5EA6E50A8C72A499E2F1FFB808DC86466A29|fenA] double mutant is not viable at 25°C [pubmed|30670546]

Advertisement

The protein

Catalyzed reaction/ biological activity

• removal of RNA from Okazaki fragments [pubmed|37146086,30670546]
• magnesium-dependent exonuclease, shows highest binding affinity to 5′ overhangs in dsDNA [pubmed|31251806]

[wiki|Domains]

• 5'-3' exonuclease domain (aa 175-262) (according to UniProt)

[wiki|Cofactors]

• Mg²⁺ [pubmed|31251806]

Structure

• [PDB|1BGX] (Taq polymerase, 36% identity) [pubmed|9770525]
• [AF|P54161]

Paralogous protein(s)

• [protein|3D6DA8B52A4CB49361E67906140696FFA1EF6099|polA], one of the two proteins has to be present for viability [Pubmed|17114254]

[wiki|Localization]

• recruited to replication forks after induction of DNA damage [pubmed|31251806]

Expression and Regulation

Operons

• genes: [gene|FCDE5EA6E50A8C72A499E2F1FFB808DC86466A29|fenA]

  description: [pubmed|22383849]

Biological materials

Mutant

• MGNA-B868 (exoA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1867 NBRP B. subtilis, Japan]
• BKE22010 (Δ[gene|FCDE5EA6E50A8C72A499E2F1FFB808DC86466A29|fenA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE22010 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCAAATAACTCCCTTTTC,  downstream forward: _UP4_GCTAGAGAGATCGTTTAGAT
• BKK22010 (Δ[gene|FCDE5EA6E50A8C72A499E2F1FFB808DC86466A29|fenA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK22010 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCAAATAACTCCCTTTTC,  downstream forward: _UP4_GCTAGAGAGATCGTTTAGAT

References

• 17114254,17905985,16045613,30096406,9770525,30670546,31251806,37146086,38551349,38551349