ylxS

168

similar to ribosome maturation protein

Locus: BSU_16590

Molecular weight: 17.48 kDa

Isoelectric point: 4.48

Protein length: 156 aa

Gene length: 471 bp

Function: ribosome maturation

Product: unknown

Essential: no

Synonyms: ylxS, ymxA, rimP

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Information processing, Protein synthesis, modification and degradation, Translation, Translation/ other/ based on similarity

List of homologs in different organisms, belongs to COG0779 (Galperin et al., 2021)

This gene is a member of the following regulons

SigA regulon, SigB regulon, Stringent response, NusA regulon

Gene

Coordinates: 1,731,776  1,732,246

The protein

Protein family

RimP family (single member, according to UniProt)

Structure

1IB8 (PDB) (from Streptococcus pneumoniae, 41% identity) PubMed
P32726 (AlphaFold)

Expression and Regulation

Operons

Genes: ylxS-nusA-rnpM-rplGA-infB-ylxP-rbfA

Description: PubMed

Regulation

autoregulation NusA PubMed
induced by glucose PubMed
expression is reduced in motile cells as compared to non-motile cells PubMed

Regulatory mechanism

stringent response: negative regulation, in stringent response
NusA: attenuation, NusA stimulates termination PubMed, in nusA regulon

Sigma factors

SigA: sigma factor, PubMed, in sigA regulon
SigB: sigma factor, PubMed, in sigB regulon

Biological materials

Mutant

BKE16590 (ylxS::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATGTTCTTCCTCCTTGTGC,  downstream forward: _UP4_TAATGAATACAAATGTTTTA
BKK16590 (ylxS::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATGTTCTTCCTCCTTGTGC,  downstream forward: _UP4_TAATGAATACAAATGTTTTA

References

Loading