ykpA
168
translation factor, housekeeping subfamily F ABC ATPase, prevents ribosome stalling at charged motifs
locus
BSU_14430
Molecular weight
60.88 kDa
pI
4.98
function
prevention of ribosome stalling
product
housekeeping subfamily F ABC ATPase
essential
no
synonyms
ykpA
Outlinks
Genomic Context
Categories containing this gene/protein
List of homologs in different organisms, belongs to COG0488 (Galperin et al., 2021)
This gene is a member of the following regulons
Gene
Coordinates
1,512,373 1,513,995
The protein
Catalyzed reaction/ biological activity
promotes translation of otherwise difficult positively or negatively charged amino acid stretches [pubmed|38943426]
Protein family
[wiki|ABC transporter superfamily] (according to UniProt)
[wiki|ABCF ATPase subfamily] [pubmed|30597160]
[wiki|Domains]
2 [wiki|ABC transporter domain]s (aa 2-252, aa 320-537) (according to UniProt)
Structure
[PDB|3J5S] (EttA from E. coli, 33% identity) [pubmed|24389465]
[PDB|4FIN] (EttA from E. coli, 33% identity) [pubmed|24389466]
[AF|O31716]
Paralogous protein(s)
[protein|47B644F334A0BD501E77A198A61CE0F22BAB3E5E|yfmM], [protein|F69F15198ACF8A8347C450EEC09F000EECEDEC41|yfmR], [protein|1F56D3275386BB54A774BFA045C09E36D1268471|ydiF]
Expression and Regulation
Operons
genes
[gene|2F79DB15D359A127C2D833CC0465E18E1725F539|ykpA]
description
[pubmed|22383849]
genes
[gene|2F79DB15D359A127C2D833CC0465E18E1725F539|ykpA]-[gene|60264E4BE76F5995A8317294D05FC27F8B34E09D|panG]
description
[pubmed|22383849]
Biological materials
Mutant
MGNA-B352 (ykpA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1351 NBRP B. subtilis, Japan]
BKE14430 ([gene|2F79DB15D359A127C2D833CC0465E18E1725F539|ykpA]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE14430 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTATTATCCTCCATCAT, downstream forward: _UP4_TAAAAAAGCAGAGATTTCTC
BKK14430 ([gene|2F79DB15D359A127C2D833CC0465E18E1725F539|ykpA]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK14430 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTATTATCCTCCATCAT, downstream forward: _UP4_TAAAAAAGCAGAGATTTCTC
References
Reviews
Original Publications
Page visits: 2787
Time of last update: 2025-10-25 01:39:31
Author of last update: Jstuelk