yjjA

yjjA
168

similar to uroporphyrinogen III synthase

locus
BSU_12230
Molecular weight
29.68 kDa
pI
5.14
Protein length
Gene length
function
unknown
product
similar to uroporphyrinogen III synthase
essential
no
synonyms
yjjA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1587 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
1,294,138  1,294,950
The protein
Structure
[PDB|1WD7] (from Thermus thermophilus, 36% identity)
[AF|O34394]
Expression and Regulation
Operons
genes
[gene|3E567AD4C402CDFD544836D79DFA47BC6AE66A8F|yjjA]
description
[pubmed|22383849]
Open in new tab

[gene|3E567AD4C402CDFD544836D79DFA47BC6AE66A8F|yjjA]

2025-10-25 18:49:14

Jstuelk

85

e310fda48fdf0e747cee8f9748715e93bbf7104d

1F8399A2DA43C1CB87B14EFD25F2F8318C342C28

Biological materials
Mutant
MGNA-A364 (yjjA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/364 NBRP B. subtilis, Japan]
BKE12230 ([gene|3E567AD4C402CDFD544836D79DFA47BC6AE66A8F|yjjA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE12230 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATACCCGTTTCCTCTCCTC,  downstream forward: _UP4_TAACAAGTACAAAAAGCCGC
BKK12230 ([gene|3E567AD4C402CDFD544836D79DFA47BC6AE66A8F|yjjA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK12230 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATACCCGTTTCCTCTCCTC,  downstream forward: _UP4_TAACAAGTACAAAAAGCCGC

3E567AD4C402CDFD544836D79DFA47BC6AE66A8F

Page visits: 2154

Time of last update: 2025-10-28 21:53:26

Author of last update: Bzhu