yitI

yitI
168

similar to glyphosate N-acetyltransferase

locus
BSU_11000
Molecular weight
17.47 kDa
pI
9.17
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
2.3.1.-
synonyms
yitI

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2153 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
1,178,218  1,178,682
The protein
Protein family
[wiki|Acetyltransferase family] (according to UniProt)
[wiki|Domains]
[wiki|N-acetyltransferase domain] (aa 2-146) (according to UniProt)
Structure
[PDB|2JDC] (from B. licheniformis, 59% identity) [pubmed|17272278]
[AF|O06744]
Expression and Regulation
Operons
genes
[gene|2751630B6472346B19FB20F57F16013D0FACA9F7|yitI]-[gene|1A31885756344F8BD2BED4E4526D43D6D5AB85F3|yitH]
description
[pubmed|22383849]
Open in new tab

[gene|2751630B6472346B19FB20F57F16013D0FACA9F7|yitI]→[gene|1A31885756344F8BD2BED4E4526D43D6D5AB85F3|yitH]

2025-10-22 22:46:50

Jstuelk

92

bdb6372e020a317041d046c63380da4322654df7

AE0CE3517E22321963C7CDDEE702CD9992067DAA

Biological materials
Mutant
MGNA-B205 (yitI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1204 NBRP B. subtilis, Japan]
BKE11000 ([gene|2751630B6472346B19FB20F57F16013D0FACA9F7|yitI]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE11000 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGATTGTTTTTCTATATC,  downstream forward: _UP4_TGATCTTATGGACGTAGTAG
BKK11000 ([gene|2751630B6472346B19FB20F57F16013D0FACA9F7|yitI]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK11000 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGATTGTTTTTCTATATC,  downstream forward: _UP4_TGATCTTATGGACGTAGTAG
References
19258532,17272278, 15155947

2751630B6472346B19FB20F57F16013D0FACA9F7

Page visits: 2871

Time of last update: 2025-10-25 20:22:09

Author of last update: Melvin.boenninger