yitF
168
similar to mandelate racemase
locus
BSU_10970
Molecular weight
41.89 kDa
pI
7.53
function
unknown
product
unknown
essential
no
ec
null
synonyms
yitF
Outlinks
Genomic Context
Categories containing this gene/protein
List of homologs in different organisms, belongs to COG4948 (Galperin et al., 2021)
This gene is a member of the following regulons
Gene
Coordinates
1,174,861 → 1,175,976
The protein
Protein family
[wiki|mandelate racemase/muconate lactonizing enzyme family] (according to UniProt)
Structure
[PDB|2GDQ]
[AF|O06741]
Expression and Regulation
Operons
genes
[gene|BA1A7ECAE0B5690F6E6A67785BAB18628701E2A2|yitG]-[gene|F1A84EC28BE0E306356A331FD362E3CDAE49A3AB|yitF]
description
[Pubmed|16497325]
regulation
expressed during sporulation in the forespore ([protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]) [Pubmed|16497325,15699190]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|16497325,15699190], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Biological materials
Mutant
MGNA-B180 (yitF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1179 NBRP B. subtilis, Japan]
BKE10970 (Δ[gene|F1A84EC28BE0E306356A331FD362E3CDAE49A3AB|yitF]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE10970 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCGTACAATTTTCACACTGG, downstream forward: _UP4_TAAGCTGGGCCATTTCTTTA
BKK10970 (Δ[gene|F1A84EC28BE0E306356A331FD362E3CDAE49A3AB|yitF]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK10970 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCGTACAATTTTCACACTGG, downstream forward: _UP4_TAAGCTGGGCCATTTCTTTA
References
Page visits: 2883
Time of last update: 2025-10-25 06:10:29
Author of last update: Melvin.boenninger