yheF
168
unknown
locus
BSU_09740
Molecular weight
4.86 kDa
pI
8.14
function
unknown
product
unknown
essential
no
ec
null
synonyms
yheF
Outlinks
Genomic Context
Categories containing this gene/protein
List of homologs in different organisms
This gene is a member of the following regulons
Gene
Coordinates
1,049,801 → 1,049,926
The protein
Structure
[AF|O07547]
Expression and Regulation
Operons
genes
[gene|F222E0D443F8A6C3B12664D1A4276411281D9BAE|yheF]-[gene|3C54B09CE6C09BA8EC6A0DF2130400B1F091DF12|yheG]
description
[Pubmed|22383849]
regulation
expressed during [wiki|sporulation] [Pubmed|22383849]
Biological materials
Mutant
BKE09740 (Δ[gene|F222E0D443F8A6C3B12664D1A4276411281D9BAE|yheF]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE09740 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCCCGATTCCCTCCCTTT, downstream forward: _UP4_TGAGAACATCCTTTTATAAT
BKK09740 (Δ[gene|F222E0D443F8A6C3B12664D1A4276411281D9BAE|yheF]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK09740 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCCCGATTCCCTCCCTTT, downstream forward: _UP4_TGAGAACATCCTTTTATAAT
Page visits: 2228
Time of last update: 2025-10-27 15:42:58
Author of last update: Bzhu