mpfA

168

primary magnesium efflux pump, mutation suppresses defects in 70 S ribosome formation

locus: BSU_09550

Molecular weight: 49.69 kDa

pI: 4.4

Protein length: 444 aa

Gene length: 1335 bp

function: export of magnesium

product: magnesium efflux pump

essential: no

synonyms: mpfA, yhdP

List of homologs in different organisms, belongs to COG1253 (Galperin et al., 2021)

Gene

Coordinates: 1,032,063 → 1,033,397

Phenotypes of a mutant

• suppression of the growth defects of [gene|44D4CE353E1E532664A508CBE8B49AC8BB861B53|rplA] and [gene|5F3933197343FBBDCBD42B408837F8EEF0A0BEBD|rplW] mutants [pubmed|29967120]
• partial suppression of sporulation frequency of a [gene|44D4CE353E1E532664A508CBE8B49AC8BB861B53|rplA] mutant [pubmed|29967120]
• suppresses the Mn²⁺ sensitivity of a [gene|FF34DC303E8A7C9FAA205A6C2924961963B14EB1|mntR] [gene|353DADE8E57A0F1895CCEB62701F9273EEB5EB45|mntH] double mutant [pubmed|31964700]
• increased tolerance to Mn²⁺ and Co²⁺ [pubmed|31964700]
• resistant to high Mg²⁺ concentrations [pubmed|31964700]
• significantly delayed osmoadaptation to both high NaCl and high KCl [pubmed|35164567]

Advertisement

The protein

Protein family

• [wiki|UPF0053 family](according to UniProt)

[wiki|Domains]

• [wiki|CNNM transmembrane domain] (aa 1-201) (according to UniProt)
• [wiki|DUF21 domain] (aa 5-201)
• 2 [wiki|CBS domain]s (aa 220-282, aa 284-344) (according to UniProt)

Structure

• [PDB|4HG0] (CorC from E. coli, corresponds to the [wiki|CBS domain]s and the C-terminal transporter-associated domain)
• [AF|O07585]

Paralogous protein(s)

• [protein|E53B8D437B848B637AEC8C1BB9428EC8B6EB280E|yqhB], [protein|45F03AB13292BBF0554785C7C02FE29033EDD742|yrkA], [protein|A459410312A926365B45CEB4694DE399B38820A2|yugS], [protein|B2E9D026B668C8530C406353E3400059388566FB|yhdT]

[wiki|Localization]

• cell membrane (according to UniProt)

Expression and Regulation

Operons

• genes: [gene|EDFAF3AF6F2E7578733D5BF0295AD614070453F4|yhdQ]-[gene|BE0777DE7C40825D4DB7252EA84AAB3892578529|mpfA]

  description: [Pubmed|22383849]

Biological materials

Mutant

• HB24928 (Δ[gene|BE0777DE7C40825D4DB7252EA84AAB3892578529|mpfA]), available in [wiki|John Helmann]'s and [wiki|Jörg Stülke]'s labs
• MGNA-A696 (yhdP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/696 NBRP B. subtilis, Japan]
• BKE09550 (Δ[gene|BE0777DE7C40825D4DB7252EA84AAB3892578529|mpfA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE09550 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATTAGAACCTTCACTCTA,  downstream forward: _UP4_TAATAAGAAAAGCACCTTGT
• BKK09550 (Δ[gene|BE0777DE7C40825D4DB7252EA84AAB3892578529|mpfA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK09550 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATTAGAACCTTCACTCTA,  downstream forward: _UP4_TAATAAGAAAAGCACCTTGT

Expression vectors

• pGP2931 (N-terminal His-tag, purification from ''E. coli'', in [wiki|pWH844]), available in [wiki|Jörg Stülke]'s lab
• pGP3463 (214-349aa) (N-terminal 6xHis-tag, purification from E. coli, in [wiki|pWH844]), available in [wiki|Jörg Stülke]'s lab
• pGP3468 (214-349aa) (N-terminal 6xHis-SUMO-tag, purification from E. coli, in pET-SUMO), available in [wiki|Jörg Stülke]'s lab

References

• 10960106,22383849,25182490,27933050,29967120,31415562,31864811,31964700,35164567,36515540