yfnG

yfnG
168

similar to CDP-glucose 4,6-dehydratase

locus
BSU_07280
Molecular weight
33.96 kDa
pI
5.34
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yfnG

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0451 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
799,303  800,208
The protein
Protein family
[wiki|NAD(P)-dependent epimerase/dehydratase family] (according to UniProt)
Structure
[PDB|4EGB] (from ''Bacillus Anthracis Str.Ames'', 31% identity)
[AF|O06485]
Paralogous protein(s)
[protein|90D505CAA4FAAEB6A6AF5C278E70DF714FACB4DA|spsJ]
[protein|A51B5F9F86D2F7B690712B9EC181B1C07B312E02|ytcB], (29,5%)
Expression and Regulation
Operons
genes
[gene|B25AE6979AF12628780C4489FFED966C6B31968A|yfnH]-[gene|9836E90BD443F5269A43E5C69FCF2CCB22EDF65B|yfnG]-[gene|4148A3F8E256D9B1D667C28428D867B5B6B5F3CE|yfnF]-[gene|E3481379D3FEC02C35CB4BE17A5246A208C5C86D|yfnE]-[gene|1D0286ECDA32FB21737170B54A57D3FE482C6422|yfnD]
description
[Pubmed|22383849]
regulation
expressed during sporulation ([protein|search|SigK]) [Pubmed|15383836]
regulatory mechanism
[protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|gerE]: activation, [Pubmed|26577401], in [regulon|protein:19228BAD44E6DA3DE908DC390FDF628C18D94E65|gerE regulon]
sigma factors
[protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK]: sigma factor, [Pubmed|15383836], in [regulon|protein:24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK regulon]
[protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]: sigma factor, internal promoter in [protein|E3481379D3FEC02C35CB4BE17A5246A208C5C86D|yfnE] open reading frame [Pubmed|15383836], see [http://dbtbs.hgc.jp/COG/prom/yfnHGFED.html DBTBS] for details, in [regulon|protein:3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE regulon]
Open in new tab

[gene|B25AE6979AF12628780C4489FFED966C6B31968A|yfnH]→[gene|1D0286ECDA32FB21737170B54A57D3FE482C6422|yfnD]

2025-10-24 05:58:16

ghost

150

0c2ff262cf65580a1faaadb4e41f48ec944f3022

1D656EAE328F52D0DE485D0C416B05C0B1DB28D2

Biological materials
Mutant
MGNA-C325 (yfnG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2323 NBRP B. subtilis, Japan]
BKE07280 ([gene|9836E90BD443F5269A43E5C69FCF2CCB22EDF65B|yfnG]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE07280 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ATTTTTCCAGAAACTCAAAT,  downstream forward: _UP4_TAATGTGAAACGAGGTGAAC
BKK07280 ([gene|9836E90BD443F5269A43E5C69FCF2CCB22EDF65B|yfnG]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK07280 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ATTTTTCCAGAAACTCAAAT,  downstream forward: _UP4_TAATGTGAAACGAGGTGAAC
References
15383836,26577401

9836E90BD443F5269A43E5C69FCF2CCB22EDF65B

Page visits: 2843

Time of last update: 2025-10-24 17:53:57

Author of last update: Jstuelk