ydbL

ydbL
168

unknown

locus
BSU_04510
Molecular weight
12.79 kDa
pI
9.14
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
ydbL

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
504,689  505,024
The protein
Structure
[AF|P96607]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|1ABCCA1901C9D2761B279D5474CDE6B3E8B5825C|ydbL]
description
[Pubmed|22383849]
Open in new tab

[gene|1ABCCA1901C9D2761B279D5474CDE6B3E8B5825C|ydbL]

2025-10-19 16:16:24

Jstuelk

73

0ad7f284813a1b197ea86fcc5472be9ae69c98ce

D491FEA1B8E5F76362834573A85BE44346C6F5D3

Biological materials
Mutant
MGNA-C094 (ydbL::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2092 NBRP B. subtilis, Japan]
BKE04510 ([gene|1ABCCA1901C9D2761B279D5474CDE6B3E8B5825C|ydbL]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE04510 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATCGAGACACCTCCGTCA,  downstream forward: _UP4_TAATCGCGCTGTTCCCTTGG
BKK04510 ([gene|1ABCCA1901C9D2761B279D5474CDE6B3E8B5825C|ydbL]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK04510 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATCGAGACACCTCCGTCA,  downstream forward: _UP4_TAATCGCGCTGTTCCCTTGG

1ABCCA1901C9D2761B279D5474CDE6B3E8B5825C

Page visits: 2324

Time of last update: 2025-10-25 14:28:00

Author of last update: Melvin.boenninger