ydbL
168
unknown
locus
BSU_04510
Molecular weight
12.79 kDa
pI
9.14
function
unknown
product
unknown
essential
no
ec
null
synonyms
ydbL
Outlinks
Genomic Context
Categories containing this gene/protein
List of homologs in different organisms
This gene is a member of the following regulons
Gene
Coordinates
504,689 505,024
The protein
Structure
[AF|P96607]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|1ABCCA1901C9D2761B279D5474CDE6B3E8B5825C|ydbL]
description
[Pubmed|22383849]
Biological materials
Mutant
MGNA-C094 (ydbL::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2092 NBRP B. subtilis, Japan]
BKE04510 ([gene|1ABCCA1901C9D2761B279D5474CDE6B3E8B5825C|ydbL]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE04510 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATCGAGACACCTCCGTCA, downstream forward: _UP4_TAATCGCGCTGTTCCCTTGG
BKK04510 ([gene|1ABCCA1901C9D2761B279D5474CDE6B3E8B5825C|ydbL]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK04510 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATCGAGACACCTCCGTCA, downstream forward: _UP4_TAATCGCGCTGTTCCCTTGG
Page visits: 2324
Time of last update: 2025-10-25 14:28:00
Author of last update: Melvin.boenninger