yczH
168
unknown
locus
BSU_04020
Molecular weight
20.93 kDa
pI
8.89
function
unknown
product
unknown
essential
no
ec
null
synonyms
yczH
Outlinks
Genomic Context
Categories containing this gene/protein
List of homologs in different organisms, belongs to COG0412 (Galperin et al., 2021)
This gene is a member of the following regulons
Gene
Coordinates
454,652 455,260
The protein
Protein family
dienelactone hydrolase family (with [protein|19B1345F36B2320F0714B8EF1B939C65FA7E382D|ytaP], according to UniProt)
Structure
[PDB|1ZI6] (Carboxymethylenebutenolidase from Pseudomonas putida, corresponds to aa 3 ... 123, 23.9%) [pubmed|15983415]
[AF|O31482]
Expression and Regulation
Operons
genes
[gene|025BB89AF2AAAC5BCF780A7FE0E23042E85BB743|yczH]
description
[pubmed|22383849]
Biological materials
Mutant
MGNA-C070 (yczH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2068 NBRP B. subtilis, Japan]
BKE04020 ([gene|025BB89AF2AAAC5BCF780A7FE0E23042E85BB743|yczH]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE04020 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACGGCCTCCTTTTGTG, downstream forward: _UP4_TAAACGTGCACGGCGCTTTA
BKK04020 ([gene|025BB89AF2AAAC5BCF780A7FE0E23042E85BB743|yczH]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK04020 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACGGCCTCCTTTTGTG, downstream forward: _UP4_TAAACGTGCACGGCGCTTTA
References
Research papers
Page visits: 2105
Time of last update: 2025-10-25 07:15:44
Author of last update: Jstuelk