ycxB
168
unknown
locus
BSU_03540
Molecular weight
21.89 kDa
pI
9.68
function
unknown
product
unknown
essential
no
ec
null
synonyms
ycxB
Outlinks
Genomic Context
Categories containing this gene/protein
List of homologs in different organisms
This gene is a member of the following regulons
Gene
Coordinates
404,458 → 405,015
The protein
Structure
[AF|Q08793]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|20AE0AE853AD334D4CC8E3D6466BD282E1A2074E|ycxC]-[gene|E17BB82EB15EFB221C6672A44E71DBEFC5D19B3E|ycxB]
description
[pubmed|22383849]
genes
[gene|E17BB82EB15EFB221C6672A44E71DBEFC5D19B3E|ycxB]
description
[pubmed|22383849]
Biological materials
Mutant
MGNA-C058 (ycxB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2056 NBRP B. subtilis, Japan]
BKE03540 (Δ[gene|E17BB82EB15EFB221C6672A44E71DBEFC5D19B3E|ycxB]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE03540 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACGGTAAACCTACACCT, downstream forward: _UP4_CAGCATTGACAGTGCTGATC
BKK03540 (Δ[gene|E17BB82EB15EFB221C6672A44E71DBEFC5D19B3E|ycxB]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK03540 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACGGTAAACCTACACCT, downstream forward: _UP4_CAGCATTGACAGTGCTGATC
Page visits: 2583
Time of last update: 2025-10-25 00:58:50
Author of last update: Melvin.boenninger