yabE

168

similar to cell wall binding protein

Locus: BSU_00400

Molecular weight: 47.55 kDa

Isoelectric point: 9.28

Protein length: 437 aa

Gene length: 1314 bp

Function: unknown

Product: unknown

Essential: no

Synonyms: yabE

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Cellular processes, Cell envelope and cell division, Cell wall/ other/ based on similarity

List of homologs in different organisms, belongs to COG3584 (Galperin et al., 2021)

This gene is a member of the following regulons

SigA regulon

Gene

Coordinates: 48,629 → 49,942

The protein

Domains

G5 domain (aa 236-316) (according to UniProt)

Structure

P37546 (AlphaFold)

Expression and Regulation

Operons

Genes: yabE

Description: PubMed

Sigma factors

SigA: sigma factor, PubMed, in sigA regulon

Additional information

expression is negatively controlled by a cis-acting antisense RNA that is dependent on SigX and SigM PubMed

Additional information

the mRNA is cleaved by RNase III PubMed

Biological materials

Mutant

MGNA-B905 (yabE::erm), available at the NBRP B. subtilis, Japan
BKE00400 (ΔyabE::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CAAAAGCTCAGTGTCCTCTT,  downstream forward: _UP4_TAGTATATACTTATGTATTC
BKK00400 (ΔyabE::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CAAAAGCTCAGTGTCCTCTT,  downstream forward: _UP4_TAGTATATACTTATGTATTC

Labs working on this gene/protein

John Helmann, Cornell University, USA Homepage

References

Loading