thrS
168
threonyl-tRNA synthetase (major)
locus
BSU_28950
Molecular weight
73.34 kDa
pI
5.21
function
translation
product
threonyl-tRNA synthetase (major)
essential
no
ec
6.1.1.3
synonyms
thrS
Outlinks
Genomic Context
Categories containing this gene/protein
List of homologs in different organisms, belongs to COG0441 (Galperin et al., 2021)
This gene is a member of the following regulons
Gene
Coordinates
2,959,257 2,961,188
The protein
Catalyzed reaction/ biological activity
ATP + L-threonine + tRNAThr --> AMP + diphosphate + H+ + L-threonyl-tRNAThr (according to UniProt)
Protein family
[wiki|Class-II aminoacyl-tRNA synthetase family] (according to UniProt)
[wiki|Domains]
[wiki|TGS domain] (aa 3-64) (according to UniProt)
Structure
[PDB|1TJE] (from ''Escherichia coli'', 44% identity, 63% similarity) [Pubmed|15525511]
[AF|P18255]
Modification
Cys573 is S-bacillithiolated by NaOCl stress [Pubmed|22938038]
Paralogous protein(s)
[protein|CA74CB721842927F67FBC3B5C27D2EE46B30CE1C|thrZ], one of the two proteins has to be present for viability [Pubmed|17114254]
Additional information
subject to Clp-dependent proteolysis upon glucose starvation [Pubmed|17981983]
belongs to the 100 most abundant proteins [PubMed|15378759]
Expression and Regulation
Operons
genes
[gene|3E1131CFA3EDEB3865638F09BE2F6B6ED2570BE2|thrS]
description
[Pubmed|8969504]
regulation
expression transiently increases in the forespore [Pubmed|22848659]
the [wiki|T-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
regulatory mechanism
T-box: RNA switch, in [regulon|other_regulator:T-box|T-box]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|8288542], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
genes
[gene|2AEF6D56D884CA6A0BD50FABD27F405DC2B506C7|dnaB]-[gene|AC1B507C6B1640E9BEA1F9F01628120F3680C976|dnaI]-[gene|72A4458679EA1451FA3B63D44C3BE93ACA8B397F|ytxB]-[gene|3EE0D03469D893515CAA4961BF923BE3A6769535|ytxC]-[gene|3E1131CFA3EDEB3865638F09BE2F6B6ED2570BE2|thrS]
description
[Pubmed|22383849]
Biological materials
Mutant
BKE28950 ([gene|3E1131CFA3EDEB3865638F09BE2F6B6ED2570BE2|thrS]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE28950 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTTGTCACTCCTTTTT, downstream forward: _UP4_TAAAATAAAAAAGCATGATC
BKK28950 ([gene|3E1131CFA3EDEB3865638F09BE2F6B6ED2570BE2|thrS]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK28950 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTTGTCACTCCTTTTT, downstream forward: _UP4_TAAAATAAAAAAGCATGATC
References
Page visits: 5764
Time of last update: 2025-10-27 20:26:41
Author of last update: Melvin.boenninger