steT
168
serine/ threonine exchanger transporter
locus
BSU_12860
Molecular weight
46.99 kDa
pI
9.18
function
exchange of serine and threonine
product
serine/ threonine exchanger transporter
essential
no
synonyms
steT, ykbA
Outlinks
Genomic Context
Categories containing this gene/protein
List of homologs in different organisms, belongs to COG0531 (Galperin et al., 2021)
This gene is a member of the following regulons
Gene
Coordinates
1,351,375 → 1,352,691
The protein
Protein family
[wiki|amino acid-polyamine-organocation (APC) superfamily] (according to UniProt)
Structure
[PDB|6F34] (from Geobacillus kaustophilus, 25% identity) [pubmed|29416041]
[AF|O34739]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|BCED6015E8CD17F94E9D0BC6CFEB15BF42F890A5|steT]
description
[Pubmed|22383849]
regulation
expression activated by glucose (4.2 fold) [Pubmed|12850135]
regulatory mechanism
[protein|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|purR]: repression, [pubmed|34967415], in [regulon|protein:A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|purR regulon]
Biological materials
Mutant
GP2378 ∆''[gene|BCED6015E8CD17F94E9D0BC6CFEB15BF42F890A5|steT]'' ::''cat'', available in [wiki|Jörg Stülke]'s lab [pubmed|32743959]
GP2945 ∆''[gene|BCED6015E8CD17F94E9D0BC6CFEB15BF42F890A5|steT]'' ::''kan'', available in [wiki|Jörg Stülke]'s lab
MGNA-A736 (ykbA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/736 NBRP B. subtilis, Japan]
BKE12860 (Δ[gene|BCED6015E8CD17F94E9D0BC6CFEB15BF42F890A5|steT]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE12860 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCCTTAACCTCCTATG, downstream forward: _UP4_TGATAAAACGGTTCCCTTGT
BKK12860 (Δ[gene|BCED6015E8CD17F94E9D0BC6CFEB15BF42F890A5|steT]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK12860 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCCTTAACCTCCTATG, downstream forward: _UP4_TGATAAAACGGTTCCCTTGT
lacZ fusion
pGP2275 (in [wiki|pAC5]) (GP2962), available in [wiki|Jörg Stülke]'s lab
References
Page visits: 5246
Time of last update: 2025-10-27 07:29:54
Author of last update: Jstuelk