sspA

168

small acid-soluble spore protein (major alpha-type SASP)

Locus: BSU_29570

Molecular weight: 6.93 kDa

Isoelectric point: 4.73

Protein length: 69 aa

Gene length: 210 bp

Function: protection of spore DNA

Product: small acid-soluble spore protein (major alpha-type SASP)

Essential: no

Synonyms: sspA

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG5852 (Galperin et al., 2021)

Gene

Coordinates: 3,025,445  3,025,654

Phenotypes of a mutant

• a sspA mutant is sensitive to ionizing radiation PubMed
• a sspA sspB double mutant is sensitive to blue light-induced DNA damage PubMed

The protein

Protein family

• Alpha/beta-type SASP family (according to UniProt)

Structure

• 2Z3X (PDB) (SspC in complex with DNA, 83% identity)
• P04831 (AlphaFold)

Modification

• phosphorylated on Ser-6, Ser-9-, Ser-47, and Ser-55 PubMed
• phosphorylated on Arg-55 PubMed

Paralogous protein(s)

• SspC, SspD, SspB

Expression and Regulation

Operons

• Genes: nifZ-thiI-sspA

  Description: PubMed

• Genes: sspA

  Description: PubMed

  Regulation

  • expressed late during sporulation in the forespore (SigG, SpoVT) PubMed

  Regulatory mechanism

  • SpoVT: activation, PubMed, in spoVT regulon

  Sigma factors

  • SigG: sigma factor, PubMed, in sigG regulon

  Additional information

  • the mRNA is very stable (half-life > 15 min) PubMed

Additional information

• the mRNA belongs to the 46 most abundant mRNA species in dormant spores PubMed

Biological materials

Mutant

• BP137 (''sspA::cat'') available in Fabian Commichau's lab
• 1S109 (no resistance), available at BGSC
• 1S111 (no resistance), PubMed, available at BGSC
• 1S112 (no resistance), PubMed, available at BGSC
• 1S113 (no resistance), PubMed, available at BGSC
• BKE29570 (sspA::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATGTGTCTCACCTCCTTGT,  downstream forward: _UP4_TAATTTACAATTTCACATAA
• BKK29570 (sspA::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATGTGTCTCACCTCCTTGT,  downstream forward: _UP4_TAATTTACAATTTCACATAA

References

Reviews

Loading

Original Publications

Loading