spoVD

spoVD
168

mother-cell specific class B penicillin-binding protein (spore cortex)

locus
BSU_15170
Molecular weight
71.08 kDa
pI
8.85
Protein length
Gene length
function
synthesis of spore peptidoglycan
product
penicillin-binding protein (spore cortex)
essential
no
synonyms
spoVD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0768 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
1,584,214  1,586,154
The protein
Catalyzed reaction/ biological activity
synthesis of spore peptidoglycan [pubmed|8289242]
protects [protein|5DE602D97D903D9AE38ED05D5A5F1B3A2DC1D58E|spoVE] from proteolytic degradation [Pubmed|20417640]
Protein family
[wiki|transpeptidase family] (according to UniProt)
[wiki|Domains]
C-terminal [wiki|PASTA domain] (aa 580-638) [Pubmed|25481876]
Structure
[PDB|1PYY] (PBP2B from Spreptococcus pneumoniae, 26% identity) [pubmed|12923202]
[AF|Q03524]
Effectors of protein activity
intramolecular disulfide bonds between two Cys residues are reduced by [protein|0B299F9459023306FA91298A6162A09E4A87C3B2|stoA], this is rquired for activity of SpoVD [Pubmed|19919673]
Paralogous protein(s)
[protein|EBEFF9E0A524DCDA19382E5401B923B805E4C559|pbpB]
[wiki|Localization]
intermembrane space that separates forespores from mother cells [Pubmed|19919673]
outer forespore membrane [pubmed|20417640]
Expression and Regulation
Operons
genes
[gene|38FD9805815BBDDD83789F0F402C0FB221B65FF4|spoVD]
description
[Pubmed|8436954]
regulation
expressed during sporulation in the mother cell ([protein|search|SigE]) [Pubmed|15699190,15758244]
regulatory mechanism
[protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|spoIIID]: repression, [Pubmed|9006059], in [regulon|protein:90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|spoIIID regulon]
sigma factors
[protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]: sigma factor, [Pubmed|15699190,15758244], in [regulon|protein:3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE regulon]
Open in new tab

[gene|38FD9805815BBDDD83789F0F402C0FB221B65FF4|spoVD]

2025-10-18 06:59:20

ghost

115

b620dc7308a4df8056d4d80428c36a5d65e202e4

50ADE4D84D0B81A4AB60A640036FED0688661D02

Biological materials
Mutant
1A975 ( ''spoVD''::''cat''), [Pubmed|19212404], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A975&Search=1A975 BGSC]
BKE15170 ([gene|38FD9805815BBDDD83789F0F402C0FB221B65FF4|spoVD]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE15170 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAGAGACCGTTCACTCCTT,  downstream forward: _UP4_TGATTCGGGCTGCCTATTCT
BKK15170 ([gene|38FD9805815BBDDD83789F0F402C0FB221B65FF4|spoVD]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK15170 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAGAGACCGTTCACTCCTT,  downstream forward: _UP4_TGATTCGGGCTGCCTATTCT
References
Reviews
19919674,33709487,35638784,36411352
Original Publications
9006059,8289242,15699190,15758244,8436954,9006059,19919673,20417640,23789716,25481876,28383125,29661861,12923202,33573199,36815589

38FD9805815BBDDD83789F0F402C0FB221B65FF4

Page visits: 5838

Time of last update: 2025-10-27 03:18:56

Author of last update: Jstuelk