spoIIIAD

168

component of the SpoIIIA-SpoIIQ type III secretion system residing in the forespore membrane, required for SigG activation

Locus: BSU_24400

Molecular weight: 14.27 kDa

Isoelectric point: 4.73

Protein length: 133 aa

Gene length: 402 bp

Function: activation of SigG

Product: component of a type III secretion system

Essential: no

Synonyms: spoIIIAD

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Information processing, Protein synthesis, modification and degradation, Protein secretion

Lifestyles, Sporulation, Sporulation proteins, Sporulation proteins/ other

Groups of genes, Membrane proteins

List of homologs in different organisms, belongs to COG5825 (Galperin et al., 2021)

This gene is a member of the following regulons

SpoIIID regulon, SigE regulon

Gene

Coordinates: 2,535,544  2,535,945

The protein

Structure

P49781 (AlphaFold)

Localization

membrane protein PubMed

Expression and Regulation

Operons

Genes: yqhV-spoIIIAA-spoIIIAB-spoIIIAC-spoIIIAD-spoIIIAE-spoIIIAF-spoIIIAG-spoIIIAH

Description: PubMed

Regulation

both promoters: expressed during sporulation in the mother cell (SigE) PubMed, switched off by SpoIIID PubMed

Regulatory mechanism

SpoIIID: repression, PubMed, in spoIIID regulon

Sigma factors

SigE: sigma factor, PubMed, in sigE regulon

Genes: spoIIIAA-spoIIIAB-spoIIIAC-spoIIIAD-spoIIIAE-spoIIIAF-spoIIIAG-spoIIIAH

Description: PubMed

Regulation

both promoters: expressed during sporulation in the mother cell (SigE) PubMed, switched off by SpoIIID PubMed

Biological materials

Mutant

BKE24400 (spoIIIAD::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_AACAATGTCAATCTGCAAGC,  downstream forward: _UP4_TCATAACCGAAAGGAGGCGG
BKK24400 (spoIIIAD::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_AACAATGTCAATCTGCAAGC,  downstream forward: _UP4_TCATAACCGAAAGGAGGCGG

References

Reviews

Galperin MY, Yutin N, Wolf YI, Vera Alvarez R, Koonin EVConservation and Evolution of the Sporulation Gene Set in Diverse Members of the Firmicutes.Journal of bacteriology. 2022 May 31; :e0007922. PMID: 35638784
Soto-Avila L, Merce RC, Santos W, Castañeda N, Gutierrez-Ríos RMDistribution and preservation of the components of the engulfment. What is beyond representative genomes?PloS one. 2021; 16(3):e0246651. PMID: 33651833
Ramos-Silva P, Serrano M, Henriques AO From root to tips: sporulation evolution and specialization in Bacillus subtilis and the intestinal pathogen Clostridioides difficile. Molecular biology and evolution. 2019 Jul 27; . pii:msz175. doi:10.1093/molbev/msz175. PMID:31350897
Morlot C, Rodrigues CDAThe New Kid on the Block: A Specialized Secretion System during Bacterial Sporulation.Trends in microbiology. 2018 Aug; 26(8):663-676. PMID: 29475625

Original Publications

Nagler K, Krawczyk AO, De Jong A, Madela K, Hoffmann T, Laue M, Kuipers OP, Bremer E, Moeller R Identification of Differentially Expressed Genes during Bacillus subtilis Spore Outgrowth in High-Salinity Environments Using RNA Sequencing. Frontiers in microbiology. 2016; 7:1564. . PMID:27766092
Doan T, Morlot C, Meisner J, Serrano M, Henriques AO, Moran CP, Rudner DZ Novel secretion apparatus maintains spore integrity and developmental gene expression in Bacillus subtilis. PLoS genetics. 2009 Jul; 5(7):e1000566. doi:10.1371/journal.pgen.1000566. PMID:19609349
Camp AH, Losick R A novel pathway of intercellular signalling in Bacillus subtilis involves a protein with similarity to a component of type III secretion channels. Molecular microbiology. 2008 Jul; 69(2):402-17. doi:10.1111/j.1365-2958.2008.06289.x. PMID:18485064
Illing N, Errington J The spoIIIA operon of Bacillus subtilis defines a new temporal class of mother-cell-specific sporulation genes under the control of the sigma E form of RNA polymerase. Molecular microbiology. 1991 Aug; 5(8):1927-40. . PMID:1766372