salA
168
negative regulator of [gene|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|scoC] expression, activator of [protein|6100EA37592A2C31BC3DE79AD7948A8D6F65F6E1|ptkA] kinase activity, similar to Fe-S cluster carrier protein
locus
BSU_01540
Molecular weight
38.48 kDa
pI
5.23
function
control of alkaline protease expression
product
MRP family regulator
essential
no
synonyms
salA, ybaL
Outlinks
Genomic Context
Categories containing this gene/protein
List of homologs in different organisms, belongs to COG0489 (Galperin et al., 2021)
This gene is a member of the following regulons
Gene
Coordinates
157,421 158,479
Phenotypes of a mutant
increased expression of ''[gene|0B98DE9CE2D98FFDE9F6EEB4E94FA1E5204BD48D|aprE]'' (due to loss of repression of ''[gene|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|scoC]'' expression)
The protein
Catalyzed reaction/ biological activity
transcription repression of ''[gene|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|scoC]'' expression [wiki|26094643]
Protein family
Mrp/NBP35 ATP-binding proteins family (single member, according to UniProt)
[wiki|Domains]
DNA-binding domain: aa 1 - 60 [Pubmed|26094643]
ATP-binding Walker domain: aa 105 - 275 [Pubmed|26094643]
domain for the interaction with [protein|6100EA37592A2C31BC3DE79AD7948A8D6F65F6E1|ptkA]: aa 294 - 352
Structure
[PDB|8ZKC] (from E. coli, 32.8% identity) [pubmed|38797154]
[PDB|4V03] (MinD from Aquifex aeolicus, corresponds to C-terminal domain, aa 109 ... 344, 28% identity) [pubmed|25500731]
[AF|P50863]
Modification
[protein|6100EA37592A2C31BC3DE79AD7948A8D6F65F6E1|ptkA]-dependent phosphorylation at Tyr-327 results in better binding of the target promoter [Pubmed|26094643]
Expression and Regulation
Operons
genes
[gene|8841E35B7A90F6716C0BCD98E8D0CC05FE1CA471|salA]
description
[pubmed|22383849]
regulatory mechanism
[protein|8841E35B7A90F6716C0BCD98E8D0CC05FE1CA471|salA]: repression, in [regulon|protein:8841E35B7A90F6716C0BCD98E8D0CC05FE1CA471|salA regulon]
Biological materials
Mutant
1A919 ( ''salA''::''erm''), [Pubmed|15126467], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A919&Search=1A919 BGSC]
BKE01540 ([gene|8841E35B7A90F6716C0BCD98E8D0CC05FE1CA471|salA]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE01540 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGAACCTCACCCTTTTG, downstream forward: _UP4_TAAAAGGTGAACCGGGATTC
BKK01540 ([gene|8841E35B7A90F6716C0BCD98E8D0CC05FE1CA471|salA]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK01540 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGAACCTCACCCTTTTG, downstream forward: _UP4_TAAAAGGTGAACCGGGATTC
References
Page visits: 5992
Time of last update: 2025-10-23 17:36:13
Author of last update: Jstuelk