rpmC

168

ribosomal protein uL29

Locus: BSU_01240

Molecular weight: 7.58 kDa

Isoelectric point: 10.63

Protein length: 66 aa

Gene length: 201 bp

Function: translation

Product: ribosomal protein L29 (uL29)

Essential: no

Synonyms: rpmC

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG0255 (Galperin et al., 2021)

Gene

Coordinates: 139,924  140,124

The protein

Protein family

• universal ribosomal protein uL29 family (single member, according to UniProt)

Structure

• 3J9W (PDB) (the ribosome) PubMed
• P12873 (AlphaFold)

Additional information

• this ribosomal protein is lacking in some organisms with very small genomes PubMed

Expression and Regulation

Operons

• Genes: rpsJ-rplC-rplD-rplW-rplB-rpsS-rplV-rpsC-rplP-rpmC-rpsQ-rplN-rplX-rplE-rpsN-rpsH-rplF-rplR-rpsE-rpmD-rplO-secY-adk-map-oapB-infA-rpmJ-rpsM-rpsK-S56-rpoA-rplQ

  Description: PubMed

  Regulation

  • strongly repressed in response to glucose starvation in M9 medium PubMed
  • likely autorepression of operon expression upon binding of excess of one ribosomal protein to the untranslated region of the mRNA PubMed
  • expression is reduced in motile cells as compared to non-motile cells PubMed

  Regulatory mechanism

  • stringent response: negative regulation, in stringent response

  Sigma factors

  • SigA: sigma factor, PubMed (two promoters, about 140bp and 200bp upstream of the start codon), in sigA regulon

  Additional information

  • term-seq has identified a potential novel regulatory RNA element (protein-dependent leader) including an intrinsic transcription terminator upstream of rpsJ PubMed

Biological materials

Mutant

• BKE01240 (rpmC::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTAGCTTTCATTTGATTC,  downstream forward: _UP4_TAATCACTGAGGGGAGGTCG
• BKK01240 (rpmC::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTAGCTTTCATTTGATTC,  downstream forward: _UP4_TAATCACTGAGGGGAGGTCG

References

Loading