rocG
168
trigger enzyme, [metabolite|glutamate] dehydrogenase and effector protein for [protein|87BCAE725B02860156D50E1783F6DB68510C811E|gltC]
locus
BSU_37790
Molecular weight
46.48 kDa
pI
6.28
function
[metabolite|arginine] utilization, controls the activity of [protein|87BCAE725B02860156D50E1783F6DB68510C811E|gltC]
product
[metabolite|glutamate] dehydrogenase
essential
no
ec
1.4.1.2
synonyms
rocG
Outlinks
Genomic Context
Categories containing this gene/protein
List of homologs in different organisms, belongs to COG0334 (Galperin et al., 2021)
This gene is a member of the following regulons
Gene
Coordinates
3,880,740 3,882,014
Phenotypes of a mutant
Poor growth on complex media such as SP (sporulation medium). No growth in minimal media with [metabolite|arginine] as the only carbon source. Rapid accumulation of suppressor mutants ([gene|C36C8C9EEDCAD392D9BEC9728A1E0CBFF2F4E790|''gudB1'']]])
sensitive to beta-lactam antibiotics such as cefuroxime and to fosfomycin (suppressed by activation of ''[gene|C36C8C9EEDCAD392D9BEC9728A1E0CBFF2F4E790|gudB]'') due to the downregulation of the [wiki|SigW regulon] [Pubmed|22178969]
transcription profile of a ''[gene|56CBEBCFEF5CFB4A0175498338C7AF2F45EAA3E3|rocG] [gene|C36C8C9EEDCAD392D9BEC9728A1E0CBFF2F4E790|gudB]'' mutant strain: [http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE34383&submit.x=22&submit.y=9 GEO] [Pubmed|22178969]
The protein
Catalyzed reaction/ biological activity
H2O + L-[metabolite|glutamate] + [metabolite|NAD]+ --> [metabolite|2-oxoglutarate] + H+ + [metabolite|NADH] + NH4+ (according to UniProt)
controls the activity of the [protein|87BCAE725B02860156D50E1783F6DB68510C811E|gltC] transcription activator [Pubmed|17608797]
Protein family
Glu/Leu/Phe/Val dehydrogenases family (with [protein|A52E50104B18D0A8518218C52D9CC36FDDB29AAF|bcd] and [protein|C36C8C9EEDCAD392D9BEC9728A1E0CBFF2F4E790|gudB], according to UniProt)
[wiki|Cofactors]
[metabolite|NAD]+/[metabolite|NADH] + H+
Structure
[PDB|3K92] (super-repressor mutant that is capable of constitutive inactivation of [protein|87BCAE725B02860156D50E1783F6DB68510C811E|gltC], E93K mutation) [Pubmed|20630473]
[AF|P39633]
Kinetic information
KM [[metabolite|glutamate]] = 2.9 mM, KM [ammonium] = 18 mM [Pubmed|20630473]
Paralogous protein(s)
[protein|C36C8C9EEDCAD392D9BEC9728A1E0CBFF2F4E790|gudB]
Expression and Regulation
Operons
genes
[gene|56CBEBCFEF5CFB4A0175498338C7AF2F45EAA3E3|rocG]
description
[Pubmed|10468601]
regulation
expression during spore [wiki|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
induced in the presence of arginine ([protein|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|ahrC]) [Pubmed|17183217]
induced in the presence of arginine, citrulline or ornithine (with ornithine as the molecular inducer) ([protein|BEE6F16D6A5BBC7FED9E8EB5FA6A94BBF932BBDA|rocR]) [pubmed|37343703]
regulatory mechanism
[protein|BEE6F16D6A5BBC7FED9E8EB5FA6A94BBF932BBDA|rocR]: activation, [Pubmed|10468601,12634342], in [regulon|protein:BEE6F16D6A5BBC7FED9E8EB5FA6A94BBF932BBDA|rocR regulon]
[protein|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|ahrC]: activation, [Pubmed|17183217], in [regulon|protein:62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|ahrC regulon]
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|15150224], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
sigma factors
[protein|1118A21CC581B0470EC6E7C178F2523CDCA70F93|sigL]: sigma factor, [Pubmed|10468601], in [regulon|protein:1118A21CC581B0470EC6E7C178F2523CDCA70F93|sigL regulon]
additional information
Activation by [protein|BEE6F16D6A5BBC7FED9E8EB5FA6A94BBF932BBDA|rocR] requires binding of [protein|BEE6F16D6A5BBC7FED9E8EB5FA6A94BBF932BBDA|rocR] to a downstream element [PubMed|12634342]
Biological materials
Mutant
GP747 (spc), GP810 (del tet), GP1157 (cat) all available in [wiki|Jörg Stülke]'s lab
GP726 (aphA3) available in [wiki|Jörg Stülke]'s lab [pubmed|37343703]
GP1161 (Δ[gene|C36C8C9EEDCAD392D9BEC9728A1E0CBFF2F4E790|gudB]::''aphA3'' Δ[gene|56CBEBCFEF5CFB4A0175498338C7AF2F45EAA3E3|rocG]::''Tn10 spc''), available in [wiki|Jörg Stülke]'s lab [pubmed|22178973]
BKE37790 ([gene|56CBEBCFEF5CFB4A0175498338C7AF2F45EAA3E3|rocG]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE37790 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTTTTCACCTCATTGT, downstream forward: _UP4_TAATTTGAGAAGCCTCCGCA
BKK37790 ([gene|56CBEBCFEF5CFB4A0175498338C7AF2F45EAA3E3|rocG]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK37790 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTTTTCACCTCATTGT, downstream forward: _UP4_TAATTTGAGAAGCCTCCGCA
Expression vectors
expression of native ''rocG'' in ''B. subtilis'': pGP529 (in [wiki|pBQ200]), available in [wiki|Jörg Stülke]'s lab [Pubmed|18326565]
for purification of RocG from ''E. coli'' carrying an N-terminal Strep-tag: pGP902 (in [wiki|pGP172]), a series of ''rocG'' variants is also available in [wiki|pGP172], available in [wiki|Jörg Stülke]'s lab
for expression/ purification from ''E. coli'' with N-terminal His-tag and thrombin cleavage site, in [wiki|pWH844]: pGP860, available in [wiki|Jörg Stülke]'s lab
purification from ''B. subtilis'' with an N-terminal Strep-tag, for [wiki|SPINE], (in [wiki|pGP380]): pGP1709, available in [wiki|Jörg Stülke]'s lab
two-hybrid system
''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]), available in [wiki|Jörg Stülke]'s lab
Antibody
available in [wiki|Jörg Stülke]'s lab [Pubmed|17183217]
labs
[wiki|Linc Sonenshein], Tufts University, Boston, MA, USA [http://www.tufts.edu/sackler/microbiology/faculty/sonenshein/index.html Homepage]
[wiki|Jörg Stülke], University of Göttingen, Germany [http://wwwuser.gwdg.de/~genmibio/stuelke.html Homepage]
[wiki|Fabian Commichau] Brandenburg Technical University Cottbus-Senftenberg, Germany [http://genmibio.uni-goettingen.de/index.php?id=130 Homepage]
References
Reviews
Additional publications
Enzymatic activity of RocG
Bypass of [gene|56CBEBCFEF5CFB4A0175498338C7AF2F45EAA3E3|rocG] mutations
Structural analysis of glutamate dehydrogenase
Expression of [gene|56CBEBCFEF5CFB4A0175498338C7AF2F45EAA3E3|rocG]
Function in the control of [protein|87BCAE725B02860156D50E1783F6DB68510C811E|GltC] activity
Page visits: 12555
Time of last update: 2025-10-23 03:14:06
Author of last update: Jstuelk