pucG
168
(S)-ureidoglycine-glyoxylate aminotransferase
locus
BSU_32520
Molecular weight
45.58 kDa
pI
5.42
function
purine utilization
product
(S)-ureidoglycine-glyoxylate aminotransferase
essential
no
synonyms
pucG, yurG
Outlinks
Genomic Context
Categories containing this gene/protein
List of homologs in different organisms, belongs to COG0075 (Galperin et al., 2021)
This gene is a member of the following regulons
Gene
Coordinates
3,341,166 3,342,416
The protein
Catalyzed reaction/ biological activity
transamination between an unstable intermediate ((S)-ureidoglycine) and the end product of purine catabolism (glyoxylate) to yield oxalurate and glycine [Pubmed|20852637]
(S)-2-ureidoglycine + glyoxylate --> glycine + N-carbamoyl-2-oxoglycine (according to UniProt)
Protein family
[wiki|Class-V pyridoxal-phosphate-dependent aminotransferase family] (according to UniProt)
[wiki|Cofactors]
PLP
Structure
[PDB|3ISL]\t[Pubmed|20852637]
[AF|O32148]
Expression and Regulation
Operons
genes
[gene|C314CE9D194E8894430368C5F69C0778D45A651C|pucF]-[gene|4BC4B3E0AB4779D1DD5EDF591361FC1094AF661F|pucG]
description
[Pubmed|12029039]
regulation
induced in the presence of purine nucleotides (inducer: allantoin) ([protein|52C1601482C26400A524E880334BB801F832D6ED|pucR]) [Pubmed|12029039]
expression
expression is heterogeneous [pubmed|35171018]
regulatory mechanism
[protein|52C1601482C26400A524E880334BB801F832D6ED|pucR]: activation, [Pubmed|12029039], in [regulon|protein:52C1601482C26400A524E880334BB801F832D6ED|pucR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|12029039], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Biological materials
Mutant
MGNA-A942 (yurG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/942 NBRP B. subtilis, Japan]
BKE32520 ([gene|4BC4B3E0AB4779D1DD5EDF591361FC1094AF661F|pucG]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE32520 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCCTGACACAGCCATTCCTC, downstream forward: _UP4_TAAAGAAAAGCTTGCGGAAC
BKK32520 ([gene|4BC4B3E0AB4779D1DD5EDF591361FC1094AF661F|pucG]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK32520 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCCTGACACAGCCATTCCTC, downstream forward: _UP4_TAAAGAAAAGCTTGCGGAAC
References
Page visits: 4272
Time of last update: 2025-10-26 01:50:42
Author of last update: Melvin.boenninger