moaA

moaA
168

molybdopterin precursor biosynthesis

locus
BSU_36700
Molecular weight
38.39 kDa
pI
9.28
Protein length
Gene length
function
nitrate respiration
product
unknown
essential
no
synonyms
moaA, narA, narAB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2896 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
3,772,325  3,773,350
The protein
Catalyzed reaction/ biological activity
involved in the first step of molybdenum cofactor biosynthesis (together with [protein|4A8D74B83E20FA138ED66F0D8FD456B69B740D92|ydiG])
AH2 + GTP + S-adenosyl-L-methionine --> (8S)-3',8-cyclo-7,8-dihydroguanosine 5'-triphosphate + 5'-deoxyadenosine + A + H+ + L-methionine (according to UniProt)
Protein family
[wiki|Radical SAM superfamily] (according to UniProt)
[wiki|Cofactors]
Fe-S cluster [pubmed|29292548]
S-adenosyl methionine (according to UniProt)
Structure
[PDB|1TV7] (from Staphylococcus aureus, 49% identity) [pubmed|15317939]
[AF|P39757]
Expression and Regulation
Operons
genes
[gene|095DAEED5F22A3BC46614C16CC907A2DB9E32C6E|fdhD]-[gene|19EB8E7CBC0E8D7A6429ADFFF93D1F71EFE3FF11|moaA]
description
[Pubmed|22383849]
Open in new tab

[gene|095DAEED5F22A3BC46614C16CC907A2DB9E32C6E|fdhD]→[gene|19EB8E7CBC0E8D7A6429ADFFF93D1F71EFE3FF11|moaA]

2025-10-23 03:58:26

Jstuelk

105

410b8239829f01425078c1591b355048857e9ded

6EF51E744DA5CB2F4D91D3A55A711AA8E13DA700

Biological materials
Mutant
BKE36700 ([gene|19EB8E7CBC0E8D7A6429ADFFF93D1F71EFE3FF11|moaA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE36700 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TGTAATCATAGCTACAGCCC,  downstream forward: _UP4_TAATTTGAAGTCAAAAGCTT
BKK36700 ([gene|19EB8E7CBC0E8D7A6429ADFFF93D1F71EFE3FF11|moaA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK36700 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TGTAATCATAGCTACAGCCC,  downstream forward: _UP4_TAATTTGAAGTCAAAAGCTT
References
Reviews
23539623,25268953
Original Publications
7860592,9352926,15317939

19EB8E7CBC0E8D7A6429ADFFF93D1F71EFE3FF11

Page visits: 2875

Time of last update: 2025-10-24 06:28:32

Author of last update: Melvin.boenninger