minJ

168

topological determinant of cell division, part of the Min system (with Z ring placement)

Locus: BSU_35220

Molecular weight: 43.51 kDa

Isoelectric point: 9.06

Protein length: 397 aa

Gene length: 1194 bp

Function: cell division site selection

Product: topological determinant of cell division

Essential: no

Synonyms: minJ, yvjD, swrAB

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Cellular processes, Cell envelope and cell division, Cell shape

Cellular processes, Cell envelope and cell division, Cell division, The Min system

Lifestyles, Exponential and early post-exponential lifestyles, Swarming

Groups of genes, Membrane proteins

List of homologs in different organisms, belongs to COG0265 (Galperin et al., 2021)

This gene is a member of the following regulons

SigA regulon, SigD regulon, DegU regulon

Gene

Coordinates: 3,620,346 → 3,621,539

Phenotypes of a mutant

formation of minicells PubMed
increased cell length PubMed]
inactivation of minJ reduces sporulation efficiency to 36% that of wild type cells; delayed entry into sporulation and aberrant forespores PubMed
defective in Swarming motility PubMed

The protein

Catalyzed reaction/ biological activity

The Min system prevents minicell formation adjacent to recently completed division sites by promoting the disassembly of the cytokinetic ring, thereby ensuring that cell division occurs only once per cell cycle  PubMed
required for oriC placement during spore development PubMed

Protein family

MinJ family (single member, according to UniProt)

Domains

7 transmembrane helices (aa 15- 269) (according to UniProt)
PDZ domain (aa 295 - 361) (according to UniProt)

Structure

O34375 (AlphaFold)

Localization

forms rings at the division septum PubMed
cell membrane PubMed

Additional information

about 580 molecules per cell PubMed

Expression and Regulation

Operons

Genes: swrAA/2-minJ

Description: PubMed

Regulatory mechanism

DegU: activation, DegU-P, (SigA promoter) PubMed, in degU regulon

Sigma factors

SigA: sigma factor, PubMed, in sigA regulon
SigD: sigma factor, PubMed, in sigD regulon

Genes: minJ

Description: PubMed

Biological materials

Mutant

MGNA-B648 (minJ::erm), available at the NBRP B. subtilis, Japan
BKE35220 (ΔminJ::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CACTATCTCTCACCGCCTCA,  downstream forward: _UP4_TAAAAGGCAGCCCGGCACCG
BKK35220 (ΔminJ::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CACTATCTCTCACCGCCTCA,  downstream forward: _UP4_TAAAAGGCAGCCCGGCACCG

Two-hybrid system

B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jörg Stülke's lab

Labs working on this gene/protein

Daniel Kearns, Indiana University, Bloomington, USA, homepage
Marc Bramkamp, University of Cologne, Cologne, Germany homepage

References

Reviews

Loading

Original Publications

Loading