menH

menH
168

menaquinone biosynthesis methyltransferase

locus
BSU_22750
Molecular weight
26.43 kDa
pI
8.17
Protein length
Gene length
function
biosynthesis of menaquinone
product
menaquinone biosynthesis methyltransferase
essential
no
ec
2.1.1.163
synonyms
menH, gerCB, menG

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2226 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
2,382,907 → 2,383,608
Phenotypes of a mutant
essential [http://www.ncbi.nlm.nih.gov/pubmed/?term=12682299 according to Kobayashi et al.]; however, inactivation reported by [http://www.ncbi.nlm.nih.gov/pubmed/?term=26735940 Meeske et al.] and [http://www.ncbi.nlm.nih.gov/pubmed/?term=20511502 Block et al.]
inactivation of ''[gene|DDD40AEBBCBD3C19661A72B85912E266DBF267B3|menH]'' reduces sporulation efficiency to 12.7% that of wild type cells [Pubmed|26735940]
defective in biofilm formation [pubmed|31420537]
The protein
Catalyzed reaction/ biological activity
2-demethylmenaquinol + S-adenosyl-L-methionine --> menaquinol + H+ + S-adenosyl-L-homocysteine (according to UniProt)
Protein family
[wiki|Methyltransferase superfamily] (according to UniProt)
[wiki|class I-like SAM-binding methyltransferase superfamily] (according to UniProt)
[wiki|Domains]
[wiki|AB hydrolase-1 domain] (aa 26-259) (according to InterPro)
Structure
[PDB|1OBW] (from ''Saccharomyces cerevisiae'', 31% identity) [Pubmed|9201917]
[AF|P31113]
Expression and Regulation
Operons
genes
[gene|C45A5935559F0DAAD70F808725AF730BC18A2B0A|hepS]-[gene|DDD40AEBBCBD3C19661A72B85912E266DBF267B3|menH]-[gene|3CAEA54E80A0B56EE120B881C8CDBE055AF6BDC1|hepT]-[gene|B498ED03F19B7A73878D5C947C28C2A87CAB934D|ndk]
description
[pubmed|22383849]
Open in new tab

[gene|C45A5935559F0DAAD70F808725AF730BC18A2B0A|hepS]→[gene|B498ED03F19B7A73878D5C947C28C2A87CAB934D|ndk]

2025-10-22 07:08:21

Jstuelk

171

4994bd02adb7701a42b6eebb6e0352c9f8a44e38

8B6317CB1523DAD0B462E932EA20388911064C0F

additional information
highly expressed at high iron concentrations [pubmed|31420537]
Biological materials
Mutant
BKE22750 (Δ[gene|DDD40AEBBCBD3C19661A72B85912E266DBF267B3|menH]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE22750 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTCTTTTGAGTCCTGCATAA,  downstream forward: _UP4_CTGTTTGAAGAGGCGGGCCT
BKK22750 (Δ[gene|DDD40AEBBCBD3C19661A72B85912E266DBF267B3|menH]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK22750 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTCTTTTGAGTCCTGCATAA,  downstream forward: _UP4_CTGTTTGAAGAGGCGGGCCT
References
9201917,26735940,20511502,31420537

DDD40AEBBCBD3C19661A72B85912E266DBF267B3

Page visits: 7729

Time of last update: 2025-10-25 08:12:48

Author of last update: Melvin.boenninger