pxpC

168

subunit of ATP-dependent 5-oxoprolinase, antagonist of [protein|5A5E17D39296FECC1C03B1A7791AB1065BB4E4DF|pxpB], control of the [wiki|phosphorelay]

locus: BSU_04090

Molecular weight: 36.40 kDa

pI: 5.47

Protein length: 335 aa

Gene length: 1008 bp

function: detoxification of 5-oxoproline, control of the [wiki|phosphorelay], initiation of [wiki|sporulation]

product: subunit of 5-oxoprolinase, antagonist of [wiki|KipI]

essential: no

synonyms: pxpC, kipA

List of homologs in different organisms, belongs to COG1984 (Galperin et al., 2021)

Gene

Coordinates: 460,592  461,599

Phenotypes of a mutant

• no growth with 5-oxoproline as single source of nitrogen [pubmed|28830929]
• reduced growth with ammonium as source of nitrogen due to the accumulation of toxic 5-oxoproline [pubmed|28830929]

Advertisement

The protein

Catalyzed reaction/ biological activity

• 5-oxoproline + ATP --> glutamate + ADP + P_i [pubmed|28830929]

Protein family

• PxpC family (single member, according to UniProt)

Structure

• [PDB|5DUD] ( the YbgJ-YbgK complex from E. coli, 36% identity)
• [AF|Q7WY77]

Kinetic information

• K_m (5-oxoproline): 39 M [pubmed|28830929]

Biological materials

Mutant

• BKE04090 ([gene|3BA8F1F71B1D65EB30867ABD27867F925DAD2D7B|pxpC]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE04090 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TCCGGGCTTTAATACTTTCA,  downstream forward: _UP4_CTGACATAGCAAAGGGGATG
• BKK04090 ([gene|3BA8F1F71B1D65EB30867ABD27867F925DAD2D7B|pxpC]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK04090 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TCCGGGCTTTAATACTTTCA,  downstream forward: _UP4_CTGACATAGCAAAGGGGATG

References

• 9334321,21050859,25755103,28830929