iolS

168

similar to dehydrogenase, may be involved in myo-inositol catabolism

Locus: BSU_39780

Molecular weight: 35.01 kDa

Isoelectric point: 5.38

Protein length: 310 aa

Gene length: 933 bp

Function: unknown, may be involved in myo-inositol catabolism

Product: unknown

Essential: no

Synonyms: iolS, yxbF

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Metabolism, Carbon metabolism, Utilization of specific carbon sources, Utilization of inositol

List of homologs in different organisms, belongs to COG0667 (Galperin et al., 2021)

This gene is a member of the following regulons

SigA regulon, IolR regulon

Gene

Coordinates: 4,085,608 → 4,086,540

The protein

Protein family

Aldo/keto reductase family (according to UniProt)

Structure

1PZ0 (PDB) PubMed
P46336 (AlphaFold)

Paralogous protein(s)

YhdN, YccK
YqkF, (31,4%)

Expression and Regulation

Operons

Genes: iolR-iolS

Description: PubMed

Regulation

induced by inositol (IolR) PubMed

Regulatory mechanism

IolR: repression, PubMed, in iolR regulon

Sigma factors

SigA: sigma factor, PubMed, in sigA regulon

Biological materials

Mutant

BKE39780 (ΔiolS::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATGATCTGCCTCCTAGAAT,  downstream forward: _UP4_TAAGAAGAAAACAGCCTTCT
BKK39780 (ΔiolS::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATGATCTGCCTCCTAGAAT,  downstream forward: _UP4_TAAGAAGAAAACAGCCTTCT

Labs working on this gene/protein

Yasutaro Fujita, University of Fukuyama, Japan
[[Ken-ichi Yoshida]], Kobe University, Japan

References

Loading