Explore the novel features of the upcoming release of in its beta version,
SubtiWiki v5! It features genomic conservation, interaction of proteins with metabolites, dedicated metabolite pages, and much more!
Check the pages for
MntR and
manganese!
gmuR
168
transcriptional repressor (GntR family) of the [gene|00A4A90685CED4AD46829C45718CF26F1D62F5D3|gmuB]-[gene|44014896157718D3A6190DFDBD663C5CB9DA63FC|gmuA]-[gene|76324E0A6CAA8E1DD0B0C6FAE1CAB402231BF7CC|gmuC]-[gene|D8C81A8768E9C6B47B5E196B54DC2A3A8256E7E6|gmuD]-[gene|64CA75A26A08C534EC7ADFC4A6256F07F3D4BFB7|gmuR]-[gene|EB6DE119E6FB18413DB2C2B62B114FB787164F74|gmuE]-[gene|35225776F6044513D3E77DBBD6A7A8FE976F506A|gmuF]-[gene|289ACC9D13BBFAA5C083EE525ECCC32DB06E075F|gmuG] operon
Molecular weight
27.23 kDa
function
regulation of glucomannan utilization
product
transcriptional repressor (GntR family)
Genomic Context
This gene is a member of the following
regulons
Gene
Coordinates
630,170 630,883
The protein
Protein family
[wiki|GntR family] of transcription factors
[wiki|Domains]
[wiki|HTH gntR-type domain] (aa 1-69) (according to UniProt)
Structure
[PDB|2WV0] (the structure of [protein|6D36D6360FE1CBFF5F64B2A6D1406405D6C6F7D5|nagR], 29% identity) [Pubmed|20047956]
[AF|O05509]
Paralogous protein(s)
[protein|6D36D6360FE1CBFF5F64B2A6D1406405D6C6F7D5|nagR], [protein|DC374E280C5A67C138D7EAC43AA66DA63CEF82B6|treR], [protein|F9E0C645BCCD9A299E951D0574321C1FACA8DE4C|ymfC], [protein|FB074E8CFCA1C0198457170A7AFD85C875B34DF2|gamR], [protein|59EBB1812BA939110BC00ACE30057AB987E61B30|yydK], [protein|412A1DBBE7F87765DEBEEAAE02A047636A354D5E|frlR]
Expression and Regulation
Operons
genes
[gene|00A4A90685CED4AD46829C45718CF26F1D62F5D3|gmuB]-[gene|44014896157718D3A6190DFDBD663C5CB9DA63FC|gmuA]-[gene|76324E0A6CAA8E1DD0B0C6FAE1CAB402231BF7CC|gmuC]-[gene|D8C81A8768E9C6B47B5E196B54DC2A3A8256E7E6|gmuD]-[gene|64CA75A26A08C534EC7ADFC4A6256F07F3D4BFB7|gmuR]-[gene|EB6DE119E6FB18413DB2C2B62B114FB787164F74|gmuE]-[gene|35225776F6044513D3E77DBBD6A7A8FE976F506A|gmuF]-[gene|289ACC9D13BBFAA5C083EE525ECCC32DB06E075F|gmuG]
description
[Pubmed|18177310]
regulation
induced by cellobiose ([protein|64CA75A26A08C534EC7ADFC4A6256F07F3D4BFB7|gmuR]) [Pubmed|18177310]
regulatory mechanism
[protein|64CA75A26A08C534EC7ADFC4A6256F07F3D4BFB7|gmuR]: repression, [Pubmed|18177310], in [regulon|protein:64CA75A26A08C534EC7ADFC4A6256F07F3D4BFB7|gmuR regulon]
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|18177310], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: activation, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|18177310], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab
[gene|00A4A90685CED4AD46829C45718CF26F1D62F5D3|gmuB]→[gene|289ACC9D13BBFAA5C083EE525ECCC32DB06E075F|gmuG]
2025-10-24 02:37:17
Jstuelk
155
1716709ba10a9af523abc0d89eb44ea784dd12d9
42FBC6CD7712CC913DB98C4B417CB4A13C8FAE20
Biological materials
Mutant
MGNA-C192 (ydhQ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2190 NBRP B. subtilis, Japan]
BKE05850 ([gene|64CA75A26A08C534EC7ADFC4A6256F07F3D4BFB7|gmuR]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE05850 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGGTATCCTCCGGCAGC, downstream forward: _UP4_TGATTGCGGAGACAACAAGG
BKK05850 ([gene|64CA75A26A08C534EC7ADFC4A6256F07F3D4BFB7|gmuR]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK05850 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGGTATCCTCCGGCAGC, downstream forward: _UP4_TGATTGCGGAGACAACAAGG
References
18177310,10627040,18177310,20817675,20047956