glxA

glxA
168

glyoxalase I

locus
BSU_38370
Molecular weight
14.29 kDa
pI
4.43
Protein length
Gene length
function
detoxification of [metabolite|methylglyoxal]
product
glyoxalase I
essential
no
synonyms
glxA, ipa-18r, ywbC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0346 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
3,937,135  3,937,515
Phenotypes of a mutant
increased sensitivity to methylglyoxal [Pubmed|24330391]
The protein
Catalyzed reaction/ biological activity
[metabolite|methylglyoxal] + [metabolite|bacillithiol] --> [metabolite|S-lactoyl-bacillithiol] [Pubmed|24330391]
Protein family
glyoxalase I family (with [protein|F02D4AFF60ADDDC5F5B85A3ACCA3AF803560B91E|yraH] and [protein|0A244A61A9A484F0BF083C918AE5A2C6A3F8157E|glxB], according to UniProt)
[wiki|Domains]
[wiki|VOC domain] (aa 4-126) (according to UniProt)
Structure
[PDB|1F9Z] (from E. coli, 35% identity) [pubmed|10913283]
[AF|P39586]
Expression and Regulation
Operons
genes
[gene|54E05955FF1732F434A0FAB08967573B8DD3ADD2|glxA]
description
[Pubmed|9353933]
Open in new tab

[gene|54E05955FF1732F434A0FAB08967573B8DD3ADD2|glxA]

2025-10-25 11:03:36

ghost

103

6dcf5e474217964322e7c24acc7b0c7a92c16d76

53668B6BE2BE64AA0ADA0A18B8082794880E57BC

Biological materials
Mutant
MGNA-B221 (ywbC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1220 NBRP B. subtilis, Japan]
BKE38370 ([gene|54E05955FF1732F434A0FAB08967573B8DD3ADD2|glxA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE38370 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCTGCTCCTCCTCGTAA,  downstream forward: _UP4_TAAAAATAAAGAACGTACAT
BKK38370 ([gene|54E05955FF1732F434A0FAB08967573B8DD3ADD2|glxA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK38370 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCTGCTCCTCCTCGTAA,  downstream forward: _UP4_TAAAAATAAAGAACGTACAT
GP4217 ([gene|54E05955FF1732F434A0FAB08967573B8DD3ADD2|glxA]::kan), available in Jörg Stülke's lab
two-hybrid system
''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]), available in [wiki|Jörg Stülke]'s lab
References
9353933,24330391,10913283

54E05955FF1732F434A0FAB08967573B8DD3ADD2

Page visits: 4282

Time of last update: 2025-10-28 01:10:00

Author of last update: Jstuelk