gltR

168

transcriptional regulator ([wiki|LysR family])

locus: BSU_26670

Molecular weight: 32.79 kDa

pI: 6.65

Protein length: 296 aa

Gene length: 891 bp

function: unknown

product: transcriptional regulator ([wiki|LysR family])

essential: no

synonyms: gltR, yrdL

List of homologs in different organisms, belongs to COG0583 (Galperin et al., 2021)

Gene

Coordinates: 2,725,837  2,726,727

Phenotypes of a mutant

• The function of this protein is unknown. However, certain mutant forms are able to activate expression of the [gene|44DF1B7E476AD58B3CCC39300FFE0132D0D32AD0|gltA]-[gene|AA07CC52B2DD48ACC9D3375E9D531CB1ACBE485A|gltB] operon (and thus to replace the cognate activator protein [protein|87BCAE725B02860156D50E1783F6DB68510C811E|gltC]) [pubmed|9023181,28294562]

Advertisement

The protein

Protein family

• [wiki|LysR family] (according to UniProt)

[wiki|Domains]

• [wiki|HTH lysR-type domain] (aa 1-58) (according to UniProt)

Structure

• [PDB|5Z72] (B. amyloliquefaciens [protein|FE15A41A58A8177280817CA3825764C39185021A|ccpC], 22% identity)
• [AF|P94501]

Additional information

• The function of this protein is unknown. However, certain mutant forms are able to activate expression of the [gene|44DF1B7E476AD58B3CCC39300FFE0132D0D32AD0|gltA]-[gene|AA07CC52B2DD48ACC9D3375E9D531CB1ACBE485A|gltB] operon (and thus to replace the cognate activator protein [protein|87BCAE725B02860156D50E1783F6DB68510C811E|gltC]) [pubmed|9023181,28294562]
• information on binding sites can be found in the [http://www.prodoric2.de/detail.php?acc=MX000049 PRODORIC2 database]

Expression and Regulation

Operons

• genes: [gene|544CE1370BE7444F361F62808E320CE97C3C2F93|gltR]

  description: (according to [http://dbtbs.hgc.jp/COG/prom/gltR.html DBTBS]) null

  regulatory mechanism

  • [protein|544CE1370BE7444F361F62808E320CE97C3C2F93|gltR]: negative autoregulation, in [regulon|protein:544CE1370BE7444F361F62808E320CE97C3C2F93|gltR regulon]

  sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|9023181], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]

Biological materials

Mutant

• GP3615 (spec), available in [wiki|Jörg Stülke]'s lab [pubmed|36377869]
• GP345 (erm), available in [wiki|Jörg Stülke]'s lab
• BKE26670 ([gene|544CE1370BE7444F361F62808E320CE97C3C2F93|gltR]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE26670 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTAGTCCTCCATAGTTG,  downstream forward: _UP4_TAAATAAATGGATGGAAGGC
• BKK26670 ([gene|544CE1370BE7444F361F62808E320CE97C3C2F93|gltR]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK26670 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTAGTCCTCCATAGTTG,  downstream forward: _UP4_TAAATAAATGGATGGAAGGC

Expression vectors

• pBP421 (N-terminal Strep-tag, for [wiki|SPINE], purification from ''B. subtilis'', in [wiki|pGP382]) (available in [wiki|Fabian Commichau]'s lab)

labs

• [wiki|Linc Sonenshein], Tufts University, Boston, MA, USA [http://www.tufts.edu/sackler/microbiology/faculty/sonenshein/index.html Homepage]

References

• 9023181,28294562