glnA

168

glutamine synthetase, trigger enzyme

locus: BSU_17460

Molecular weight: 50.11 kDa

pI: 4.87

Protein length: 444 aa

Gene length: 1335 bp

function: glutamine biosynthesis, control of [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA] and [protein|641C4BDD9702804642E1753A9C779E80FABB3919|glnR] activity

product: glutamine synthetase, trigger enzyme

essential: no

ec: 6.3.1.2

synonyms: glnA

List of homologs in different organisms, belongs to COG0174 (Galperin et al., 2021)

Gene

Coordinates: 1,878,425 1,879,759

Phenotypes of a mutant

• auxotrophic for glutamine
• defective in swarming motility (reduced rate of colony expansion) [pubmed|35638827]

Advertisement

The protein

Catalyzed reaction/ biological activity

• ATP + L-glutamate + NH₄⁺ --> ADP + H⁺ + L-glutamine + phosphate (according to UniProt)

Protein family

• glutamine synthetase family (single member, according to UniProt)

[wiki|Domains]

• glutamate binding flap (aa 300 ... 306: protects unstable intermediates from abberant hydrolysis)

[wiki|Cofactors]

• Mg²⁺

Structure

• [PDB|4LNN] (apo-GS) [Pubmed|24158439]
• [PDB|4S0R] (the [protein|68F4E792B99F86AE9E8F06D2200E128937331F5D|glnA]-[protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA] complex) [pubmed|25691471]
• [PDB|7TFC] (the [protein|68F4E792B99F86AE9E8F06D2200E128937331F5D|glnA]-[protein|641C4BDD9702804642E1753A9C779E80FABB3919|glnR] (C tail peptide) complex) [pubmed|35778410]
• [AF|P12425]

Modification

• phosphorylated on ser/ thr/ tyr [Pubmed|16493705]
• ''in vitro'' phosphorylated by [protein|23FF4A00C36EC1B7297F51A9EF3579B41F0B7EBA|prkC] on Thr-26, Thr-147, Ser-207, and Thr-286 [Pubmed|20389117]

Effectors of protein activity

• feedback inhibition by glutamine, glutamine binds the entrance site for glutamate
• activity is inhibited upon interaction with [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA] [Pubmed|23535029]

Kinetic information

• K(M) for: Glu: 27 mM, ATP: 2.4 mM, ammonium: 0.18 mM; v(max): 3.7 mol/min/mg

[wiki|Localization]

• cytoplasm (according to Swiss-Prot)

Additional information

• GlnA is a homooligomer of 12 subunits
• belongs to the 100 most abundant proteins [PubMed|15378759]

Biological materials

Mutant

• GP247 (''glnA::cat''), available in [wiki|Jrg Stlke]'s lab
• BKE17460 (''glnA''::''ermC'') (available at the [http://bgsc.org/ BGSC] and in [wiki|Jrg Stlke]'s lab) [pubmed|28189581]
• GP2263 (''glnA''::''ermC'') (available in [wiki|Jrg Stlke]'s lab)
• BP148 (del([gene|641C4BDD9702804642E1753A9C779E80FABB3919|glnR]-[gene|68F4E792B99F86AE9E8F06D2200E128937331F5D|glnA])::''cat''), available in [wiki|Fabian Commichau]'s lab
• GP1883 (del(''[gene|641C4BDD9702804642E1753A9C779E80FABB3919|glnR]-[gene|68F4E792B99F86AE9E8F06D2200E128937331F5D|glnA]'')::''ermC''), available in [wiki|Fabian Commichau]'s and [wiki|Jrg Stlke]'s labs
• BKE17460 ([gene|68F4E792B99F86AE9E8F06D2200E128937331F5D|glnA]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE17460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGGTAAAATTCCTCCT, downstream forward: _UP4_TAATATCTCAATCCCTTGGC
• BKK17460 ([gene|68F4E792B99F86AE9E8F06D2200E128937331F5D|glnA]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK17460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGGTAAAATTCCTCCT, downstream forward: _UP4_TAATATCTCAATCCCTTGGC

Expression vectors

• pGP174: expression/ purification from ''E. coli'', with N-terminal Strep-tag (in [wiki|pGP172]): , available in [wiki|Jrg Stlke]'s lab
• pGP177: N-terminal Strep-tag, purification from ''B. subtilis'', for [wiki|SPINE], in [wiki|pBQ200], available in [wiki|Jrg Stlke]'s lab
• pGP2832: N-terminal Strep-tag, purification from ''B. subtilis'', for [wiki|SPINE], in [wiki|pGP380], available in [wiki|Jrg Stlke]'s lab

lacZ fusion

• ''[gene|641C4BDD9702804642E1753A9C779E80FABB3919|glnR]-lacZ'': pGP189 (in [wiki|pAC7]), available in [wiki|Jrg Stlke]'s lab

Antibody

• available in [wiki|Karl Forchhammer]'s lab

labs

• [wiki|Susan Fisher], Boston, USA [http://www.bumc.bu.edu/microbiology/research/susan-h-fisher-phd/ homepage]

References

Reviews

• 10231480,18086213,22625175

Original Publications

• 19233925,20389117,8799114,18195355,11719184,12139611,2573733,8636055,19233925,16493705,16885465,6141156,2906311,20656908,16055443,25755103,18331450,16547045,8093698,21435182,23535029,24158439,15378759,25691471,26635369,26883633,29794222,35638827,35778410