fliP

168

part of the flagellar type III export apparatus (flagellar Type III secretion system), part of the CORE complex required for flagellum and nanotube assembly

Locus: BSU_16350

Molecular weight: 24.71 kDa

Isoelectric point: 5.28

Protein length: 221 aa

Gene length: 666 bp

Function: flagellum and nanotube assembly

Product: part of the type III CORE export apparatus

Essential: no

Synonyms: fliP

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG1338 (Galperin et al., 2021)

Gene

Coordinates: 1,704,863  1,705,528

Phenotypes of a mutant

• no secretion of FlgM, permanent inhibition of SigD PubMed
• deficient in both nanotube production and the associated intercellular molecular trafficking PubMed
• defective in Swarming motility PubMed

The protein

Protein family

• FliP/MopC/SpaP family (single member, according to UniProt)

Structure

• 6F2D (PDB) (the FliP-FliQ-FliR complex of Salmonella typhimurium, 53% identity) PubMed
• P35528 (AlphaFold)

Localization

• cell membrane (according to UniProt)
• flagellum basal body (according to UniProt)

Expression and Regulation

Operons

• Genes: ylxF-fliK-flgD-flgE-swrD-fliL-fliM-fliY-cheY-fliO-fliP-fliQ-fliR-flhB-flhA-flhF-flhG-cheB-cheA-cheW-cheC-cheD-sigD-swrB

  Description: PubMed

  Regulation

  • see fla-che operon

  Regulatory mechanism

  • Spo0A: repression, in spo0A regulon
  • CodY: repression, in codY regulon
  • DegU: repression, in degU regulon
  • SwrA: activation, in swrA regulon

  Sigma factors

  • SigA: sigma factor, PubMed, in sigA regulon
  • SigD: sigma factor, PubMed, in sigD regulon

• Genes: flgB-flgC-fliE-fliF-fliG-fliH-fliI-fliJ-ylxF-fliK-flgD-flgE-swrD-fliL-fliM-fliY-cheY-fliO-fliP-fliQ-fliR-flhB-flhA-flhF-flhG-cheB-cheA-cheW-cheC-cheD-sigD-swrB

  Description: PubMed

  Regulation

  • expression during spore germination is strongly reduced under conditions of osmotic stress PubMed

  Regulatory mechanism

  • Spo0A: repression, in spo0A regulon
  • SwrA: activation, in swrA regulon
  • CodY: repression, in codY regulon
  • DegU: repression, in degU regulon
  • SinR: transcription elongation, binding of the SinR-SlrR heteromer to sites within fliE and fliI results in inhibition of transcription elongation PubMed, in sinR regulon

  Sigma factors

  • SigA: sigma factor, PubMed, in sigA regulon
  • SigD: sigma factor, PubMed, in sigD regulon

Biological materials

Mutant

• BKE16350 (fliP::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_GCTTGAACTGAAAATATTTA,  downstream forward: _UP4_AGCTTTTAGGGTAGGTGCTA
• BKK16350 (fliP::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_GCTTGAACTGAAAATATTTA,  downstream forward: _UP4_AGCTTTTAGGGTAGGTGCTA

References

Reviews

Loading

Original Publications

Loading