flgD

168

flagellar hook cap, required for hook assembly

Locus: BSU_16280

Molecular weight: 15.50 kDa

Isoelectric point: 4.35

Protein length: 140 aa

Gene length: 423 bp

Function: flagellar hook assembly

Product: flagellar hook cap

Essential: no

Synonyms: flgD, ylxG

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG1843 (Galperin et al., 2021)

Gene

Coordinates: 1,699,738  1,700,160

Phenotypes of a mutant

• lack of SigD-dependent gene expression (no ''hag'' expression), no motility  PubMed
• inactivation of ''flgD'' confers resistance to high concentrations of Zn(II) PubMed
• defective in Swarming motility PubMed

The protein

Catalyzed reaction/ biological activity

• flagellar hook assembly PubMed
• assists incorporation of a FlgE monomer into the nascent hook structure PubMed

Protein family

• FlgD family (single member, according to UniProt)

Structure

• P23455 (AlphaFold)

Localization

• flagellum hook (according to UniProt)

Expression and Regulation

Operons

• Genes: ylxF-fliK-flgD-flgE-swrD-fliL-fliM-fliY-cheY-fliO-fliP-fliQ-fliR-flhB-flhA-flhF-flhG-cheB-cheA-cheW-cheC-cheD-sigD-swrB

  Description: PubMed

  Regulation

  • see fla-che operon

  Regulatory mechanism

  • Spo0A: repression, in spo0A regulon
  • CodY: repression, in codY regulon
  • DegU: repression, in degU regulon
  • SwrA: activation, in swrA regulon

  Sigma factors

  • SigA: sigma factor, PubMed, in sigA regulon
  • SigD: sigma factor, PubMed, in sigD regulon

• Genes: flgB-flgC-fliE-fliF-fliG-fliH-fliI-fliJ-ylxF-fliK-flgD-flgE-swrD-fliL-fliM-fliY-cheY-fliO-fliP-fliQ-fliR-flhB-flhA-flhF-flhG-cheB-cheA-cheW-cheC-cheD-sigD-swrB

  Description: PubMed

  Regulation

  • expression during spore germination is strongly reduced under conditions of osmotic stress PubMed

  Regulatory mechanism

  • Spo0A: repression, in spo0A regulon
  • SwrA: activation, in swrA regulon
  • CodY: repression, in codY regulon
  • DegU: repression, in degU regulon
  • SinR: transcription elongation, binding of the SinR-SlrR heteromer to sites within fliE and fliI results in inhibition of transcription elongation PubMed, in sinR regulon

  Sigma factors

  • SigA: sigma factor, PubMed, in sigA regulon
  • SigD: sigma factor, PubMed, in sigD regulon

Biological materials

Mutant

• MGNA-B104 (ylxG::erm), available at the NBRP B. subtilis, Japan
• BKE16280 (flgD::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_AGTCATTCTTCTTCCTCCAT,  downstream forward: _UP4_TAAAAACATCTGGGGGAATA
• BKK16280 (flgD::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_AGTCATTCTTCTTCCTCCAT,  downstream forward: _UP4_TAAAAACATCTGGGGGAATA

References

Reviews

Loading

Original Publications

Loading