fabHB

fabHB
168

beta-ketoacyl-acyl carrier protein synthase III

locus
BSU_10170
Molecular weight
35.27 kDa
pI
5.68
Protein length
Gene length
function
fatty acid biosynthesis
product
beta-ketoacyl-acyl carrier protein synthase III
essential
no
ec
2.3.1.180
synonyms
fabHB, yhfB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0332 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
1,092,770 → 1,093,747
The protein
Catalyzed reaction/ biological activity
acetyl-CoA + H+ + malonyl-[ACP] --> 3-oxobutanoyl-[ACP] + CO2 + CoA (according to UniProt)
Protein family
[wiki|thiolase-like superfamily] (according to UniProt)
Structure
[PDB|8VDB] [Pubmed|38310992]
[AF|O07600]
Paralogous protein(s)
[protein|40E064365588CFED483FBFED02BFC0DA531CCC4A|fabHA], one of the two proteins has to be present for viability [Pubmed|17114254]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Additional information
affinity for butyryl-CoA, but prefers acetyl-CoA in fatty acid biosynthesis [Pubmed|19820084]
Expression and Regulation
Operons
genes
[gene|FC818B3A8A3080231C1F8DE95377325C8E754DCE|fabHB]
description
[Pubmed|12737802]
regulation
induced if the cells experience a lack of malonyl-CoA ([protein|search|FapR]) [Pubmed|12737802]
regulatory mechanism
[protein|FCDE900167AE36377979E0CF7BC33C7F351B95D3|fapR]: repression, [Pubmed|12737802], in [regulon|protein:FCDE900167AE36377979E0CF7BC33C7F351B95D3|fapR regulon]
Open in new tab

[gene|FC818B3A8A3080231C1F8DE95377325C8E754DCE|fabHB]

2025-10-16 10:07:49

ghost

95

b2a2c91bc5ac9eb107345d5e16a670ae08aec7c1

A4E5F338DA5C7FD67B4407C6853E9B940ED4034E

Biological materials
Mutant
BKE10170 (Δ[gene|FC818B3A8A3080231C1F8DE95377325C8E754DCE|fabHB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE10170 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATGAATCACTCCTTATG,  downstream forward: _UP4_TAACAAAAAAAGAACTTGTT
BKK10170 (Δ[gene|FC818B3A8A3080231C1F8DE95377325C8E754DCE|fabHB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK10170 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATGAATCACTCCTTATG,  downstream forward: _UP4_TAACAAAAAAAGAACTTGTT
References
Reviews
15952903,17919287,40434073
Original Publications
12737802,17114254,10629181,10673437,19820084,21383089,25196128,30925337,38310992

FC818B3A8A3080231C1F8DE95377325C8E754DCE

Page visits: 4689

Time of last update: 2025-10-25 00:27:13

Author of last update: Jstuelk