dnaJ
168
heat-shock protein (activation of [protein|30E0AAABB803E577D0D9FBAEF9031319CABD3D89|dnaK])
locus
BSU_25460
Molecular weight
40.69 kDa
pI
7.92
function
protein quality control
product
heat-shock protein (activation of [protein|30E0AAABB803E577D0D9FBAEF9031319CABD3D89|dnaK])
essential
no
synonyms
dnaJ
Outlinks
Genomic Context
Categories containing this gene/protein
List of homologs in different organisms, belongs to COG0484 (Galperin et al., 2021)
This gene is a member of the following regulons
Gene
Coordinates
2,624,785 → 2,625,912
The protein
Protein family
dnaJ family (single member, according to UniProt)
[wiki|Domains]
J domain (aa 5-69) (according to UniProt)
Structure
[PDB|3LZ8] (from ''Klebsiella pneumoniae'', 34% identity)
[AF|P17631]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|2E57DFB4162EF0CE759C1FC42C637E1B9E4B2F7E|hrcA]-[gene|ECAB685E9038DC03FA2CC659112BB07D30DE5C8C|grpE]-[gene|30E0AAABB803E577D0D9FBAEF9031319CABD3D89|dnaK]-[gene|D4C75B39B2DAECB9D85DAD66AAD4F923C9AEBEA7|dnaJ]-[gene|70D717806F5174447E01FF33DC8299CB025888CD|yqeT]-[gene|F8DC71B29D9C9BF4CF5124D0F01A71548306B9F9|yqeU]-[gene|6ADA5AF308D96218414EA92DFF4A57BAEAD0554B|yqeV]
description
[Pubmed|9023197]
regulation
induced by heat shock ([protein|search|HrcA]) [Pubmed|1339421]
regulatory mechanism
[protein|2E57DFB4162EF0CE759C1FC42C637E1B9E4B2F7E|hrcA]: repression, [Pubmed|1339421], in [regulon|protein:2E57DFB4162EF0CE759C1FC42C637E1B9E4B2F7E|hrcA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|1339421], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Biological materials
Mutant
BKE25460 (Δ[gene|D4C75B39B2DAECB9D85DAD66AAD4F923C9AEBEA7|dnaJ]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE25460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCGCTTCACTCTCCCG, downstream forward: _UP4_TAATTATTGGATGAGGAGTT
BKK25460 (Δ[gene|D4C75B39B2DAECB9D85DAD66AAD4F923C9AEBEA7|dnaJ]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK25460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCGCTTCACTCTCCCG, downstream forward: _UP4_TAATTATTGGATGAGGAGTT
labs
[wiki|Wolfgang Schumann], Bayreuth University, Germany [http://www.genetik.uni-bayreuth.de/LSGenetik1/schumann_research.htm Homepage]
References
Reviews
Original Publications
Page visits: 4678
Time of last update: 2025-10-24 10:56:53
Author of last update: Jstuelk