cwlO

168

D,L-endopeptidase-type autolysin, primary autolytic pathway for cell elongation

Locus: BSU_34800

Molecular weight: 50.87 kDa

Isoelectric point: 5.33

Protein length: 473 aa

Gene length: 1422 bp

Function: cell wall synthesis, cell elongation

Product: endopeptidase-type autolysin

Essential: no

Synonyms: cwlO, yzkA, yvcE

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG3883 (Galperin et al., 2021)

Gene

Coordinates: 3,574,363  3,575,784

Phenotypes of a mutant

• a cwlO lytE mutant is not viable PubMed
• a cwlO sigI mutant is not viable, due to lack of expression of lytE PubMed
• a cwlO rasP mutant is not viable, due to lack of processing of RsgI and the resulting inactivity of SigI PubMed
• a cwlO ecsA mutant is not viable, due to lack of processing of RsgI and the resulting inactivity of SigI PubMed
• a cwlO ecsB mutant is not viable, due to lack of processing of RsgI and the resulting inactivity of SigI PubMed
• shorter, fatter cells, this can be rescued by addition of Mg(2+) PubMed
• the mutant cells are thicker and shorter than wild type cells PubMed
• loss of genetic competence PubMed
• defective in Swarming motility PubMed
• improved survival after DNA replication arrest imposed by inhibition of PolC activity PubMed
• poor growth of a ltaS cwlO double mutant PubMed

The protein

Catalyzed reaction/ biological activity

• cleaves the peptide bond between D-Glu (position 2 in the peptioglycan peptide) and m-diamino pimelic acid (position 3) PubMed
• degradation of gamma-polyglutamic acid PubMed

Protein family

• Peptidase C40 family (according to UniProt)

Domains

• C-terminal D,L-endopeptidase domain (NlpC/P60 domain) PubMed

Structure

• P40767 (AlphaFold)

Effectors of protein activity

• CwlO requires activation by FtsE-FtsX PubMed
• activity requires functional Mbl PubMed
• both enzymatic activities are inhibited by interaction with IseA PubMed

Localization

• extracellular (signal peptide) PubMed
• localizes to the outer lateral sidewall of the cell (via the N-terminal domain) PubMed
• cell membrane in a FtsX-dependent manner PubMed

Expression and Regulation

Operons

• Genes: cwlO

  Description: PubMed

  Regulation

  • expressed during exponential growth (WalR) PubMed
  • the leader mRNA is processed by RNase Y, this requires the RicA-RicF-RicT complex PubMed

  Regulatory mechanism

  • WalR: activation, PubMed, in walR regulon

  Sigma factors

  • SigA: sigma factor, PubMed, in sigA regulon

Biological materials

Mutant

• GP2642 (cwlO::aphA3), available in Jörg Stülke's lab
• MGNA-B643 (yvcE::erm), available at the NBRP B. subtilis, Japan
• BKE34800 (cwlO::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CACTTTTTATATCCTCCCTT,  downstream forward: _UP4_TAATAAATATGACAAGGGCC
• BKK34800 (cwlO::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CACTTTTTATATCCTCCCTT,  downstream forward: _UP4_TAATAAATATGACAAGGGCC

References

Reviews

Loading

Original Publications

Loading