bcaP

168

amino acid transporter, major transporter for isoleucine, valine and threonine, minor serine and asparagine transporter

Locus: BSU_09460

Molecular weight: 49.55 kDa

Isoelectric point: 9.73

Protein length: 465 aa

Gene length: 1398 bp

Function: uptake of branched-chain amino acids, threonine, serine, and asparagine

Product: amino acid transporter

Essential: no

Synonyms: bcaP, yhdG

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Cellular processes, Transporters, Transporters/ other, Amino acid transporters, APC superfamily

Metabolism, Amino acid/ nitrogen metabolism, Biosynthesis/ acquisition of amino acids, Biosynthesis/ acquisition of branched-chain amino acids

Metabolism, Amino acid/ nitrogen metabolism, Biosynthesis/ acquisition of amino acids, Biosynthesis/ acquisition of aspartate/ asparagine

Metabolism, Amino acid/ nitrogen metabolism, Biosynthesis/ acquisition of amino acids, Biosynthesis/ acquisition of lysine/ threonine

Metabolism, Amino acid/ nitrogen metabolism, Biosynthesis/ acquisition of amino acids, Biosynthesis/ acquisition of serine/ glycine/ alanine

Metabolism, Amino acid/ nitrogen metabolism, Utilization of amino acids, Utilization of asparagine/ aspartate

Metabolism, Amino acid/ nitrogen metabolism, Utilization of amino acids, Utilization of threonine/ glycine

Metabolism, Amino acid/ nitrogen metabolism, Utilization of amino acids, Utilization of branched-chain amino acids

Groups of genes, Membrane proteins

List of homologs in different organisms, belongs to COG0531 (Galperin et al., 2021)

This gene is a member of the following regulons

CodY regulon

Gene

Coordinates: 1,023,350  1,024,747

Phenotypes of a mutant

no phenotype for the single mutant, the triple ''bcaP brnQ braB'' mutant is strongly impaired in the transport of isoleucine and valine at low concentrations PubMed
resistant to growth inhibition by high concentrations of threonine PubMed
resistant to 4-hydroxythreonine PubMed

The protein

Catalyzed reaction/ biological activity

high affinity uptake of isoleucine and valine PubMed, (symport with H⁺)
uptake of threonine PubMed, (symport with H⁺)
uptake of serine PubMed, (symport with H⁺)
uptake of asparagine PubMed, (symport with H⁺)
uptake of diaminopropionic acid PubMed, (symport with H⁺)

Protein family

amino acid-polyamine-organocation (APC) superfamily (according to UniProt)

Structure

5OQT (PDB) (from Geobacillus kaustophilus, 60% identity) PubMed
O07576 (AlphaFold)

Paralogous protein(s)

MtrA

Localization

cell membrane PubMed

Expression and Regulation

Operons

Genes: bcaP

Description: PubMed

Regulatory mechanism

CodY: repression, PubMed, in codY regulon

Biological materials

Mutant

GP4157 (ΔbraB::aphA3, ΔbcaP::ermC), available in Jörg Stülke's lab
GP4484 (ΔbcaP::ermC), available in Jörg Stülke's lab PubMed
MGNA-B479 (bcaP::erm), available at the NBRP B. subtilis, Japan
BKE09460 (bcaP::erm  trpC2) available at BGSC and in Fabian Commichau's and Jörg Stülke's labs),  PubMed, upstream reverse: _UP1_CATTCCCCTTCAACTCCCGA,  downstream forward: _UP4_TAACCTTTTGATAAAGAGAG
BKK09460 (bcaP::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTCCCCTTCAACTCCCGA,  downstream forward: _UP4_TAACCTTTTGATAAAGAGAG

References

Loading