argC

168

N-acetyl-g-glutamyl-phosphate reductase

Locus: BSU_11190

Molecular weight: 37.92 kDa

Isoelectric point: 5.17

Protein length: 346 aa

Gene length: 1038 bp

Function: biosynthesis of arginine

Product: N-acetyl-g-glutamyl-phosphate reductase

Essential: no

E.C.: 1.2.1.38

Synonyms: argC

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG0002 (Galperin et al., 2021)

Gene

Coordinates: 1,195,034 → 1,196,071

The protein

Catalyzed reaction/ biological activity

• N-acetyl-L-glutamate 5-semialdehyde + NADP⁺ + phosphate --> H⁺ + N-acetyl-L-glutamyl 5-phosphate + NADPH (according to UniProt)

Protein family

• NAGSA dehydrogenase family (single member, according to UniProt)

Structure

• 1VKN (PDB) (from Thermotoga maritima, 43% identity)
• P23715 (AlphaFold)

Localization

• cytoplasm (according to Swiss-Prot)

Expression and Regulation

Operons

• Genes: argC-argJ-argB-argD-carA-carB-argF

  Description: PubMed

  Regulation

  • repressed by arginine (AhrC) PubMed
  • induced in the absence of RnpM PubMed

  Regulatory mechanism

  • AhrC: repression, PubMed, in ahrC regulon
  • CodY: repression, PubMed, in codY regulon
  • RnpM: unknown, PubMed, in rnpM regulon

  Sigma factors

  • SigA: sigma factor, PubMed, in sigA regulon

Biological materials

Mutant

• BKE11190 (ΔargC::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CAAAACAAGTTCACCCTCTT,  downstream forward: _UP4_CCATAGAACGGGAGAGAATC
• BKK11190 (ΔargC::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CAAAACAAGTTCACCCTCTT,  downstream forward: _UP4_CCATAGAACGGGAGAGAATC
• GP3708 (argC::aphA3 trpC2) available in the Stülke lab

Expression vectors

• pGP3770: expression of Strep-argC by pGP380 in B. subtilis suitable for SPINE, available in Jörg Stülke's lab
• pGP3775: IPTG inducible expression, purification in E. coli with N-terminal Strep-tag, in pGP172, available in Jörg Stülke's lab
• pGP3785: IPTG inducible expression, purification in E. coli with N-terminal His-tag, in pWH844, available in Jörg Stülke's lab
• pGP3851: expression of argC (gapA RBS) by pBQ200 in B. subtilis, available in Jörg Stülke's lab

References

Loading