SubtiWiki SubtiWiki
mntR

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

mntR
168

transcriptional regulator, controls manganese import and efflux

locus
BSU_24520
Molecular weight
16.60 kDa
pI
5.63
Protein length
Gene length
function
regulation of manganese transport
product
transcriptional regulator (DtxR family)
essential
no
synonyms
mntR, yqhN

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1321

This gene is a member of the following regulons

Gene
Coordinates
2,543,440 → 2,543,868
Phenotypes of a mutant
inactivation of ''[gene|FF34DC303E8A7C9FAA205A6C2924961963B14EB1|mntR]'' reduces sporulation efficiency to 8.9% that of wild type cells [Pubmed|26735940]
highly sensitive to Mn(II) intoxication [Pubmed|27748968], this can be suppressed by mutations that inactivate [protein|353DADE8E57A0F1895CCEB62701F9273EEB5EB45|mntH] [pubmed|31964700]
The protein
Protein family
DtxR/MntR family (single member, according to UniProt)
[wiki|Domains]
HTH dtxR-type domain (aa 1-63) (according to UniProt)
[wiki|Cofactors]
Mn(2+) acts as co-repressor (according to [Pubmed|20408793])
Structure
[PDB|2F5D] (complex with manganese) [pubmed|16533030]
[PDB|2HYG] (apo-form)
Expression and Regulation
Operons
genes
[gene|FF34DC303E8A7C9FAA205A6C2924961963B14EB1|mntR]
description
[pubmed|22383849]
Open in new tab

[gene|FF34DC303E8A7C9FAA205A6C2924961963B14EB1|mntR]

2021-10-14 13:32:06

Jstuelk

4

8c297ff8e026fc3f440b348f63f4f2d1cbc7719c

012134C3E767C579800BBBF24B32F57C6FC2ED29

genes
[gene|19CEB80CF637F1FED7C493EF743B4BFA632C8D44|lipM]-[gene|FF34DC303E8A7C9FAA205A6C2924961963B14EB1|mntR]
description
[pubmed|22383849]
Open in new tab

[gene|19CEB80CF637F1FED7C493EF743B4BFA632C8D44|lipM]->[gene|FF34DC303E8A7C9FAA205A6C2924961963B14EB1|mntR]

2021-10-06 10:28:50

Jstuelk

6

43142196e46b9630ee956a30cb1c43887eb0465a

68845A224A7971C2B25ADC30013D1BE3E2F7504C

Biological materials
Mutant
MGNA-C435 (yqhN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2433 NBRP B. subtilis, Japan]
BKE24520 (Δ[gene|FF34DC303E8A7C9FAA205A6C2924961963B14EB1|mntR]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24520 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCGAAACCCTCCCAAAAA,  downstream forward: _UP4_TAAAAAGGCGGTCTCGAAGG
BKK24520 (Δ[gene|FF34DC303E8A7C9FAA205A6C2924961963B14EB1|mntR]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24520 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCGAAACCCTCCCAAAAA,  downstream forward: _UP4_TAAAAAGGCGGTCTCGAAGG
labs
[wiki|John Helmann], Cornell University, USA [http://www.micro.cornell.edu/research/labs/helmann-lab/index.cfm Homepage]
[wiki|Richard Brennan], Houston, Texas, USA [http://www.mdanderson.org/departments/biochem/display.cfm?id=556ef368-6c81-4043-b74f350d41dd06cb&method=displayfull&pn=a8427ebd-d0ff-11d4-80fd00508b603a14 Homepage]
References
Reviews
20408793,25160631
Original Publications
17176058,12675807,17118401,16533030,15736948,14580210,12847518,23298157,12950915,10760146,26735940,27748968,31685536,31818924,31964700

FF34DC303E8A7C9FAA205A6C2924961963B14EB1

Page visits: 2155

Time of last update: 2021-10-20 06:52:21

Author of last update: Jstuelk