SubtiWiki SubtiWiki
pdxK

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

pdxK
168

pyridoxine, pyridoxal, and pyridoxamine kinase

locus
BSU_38020
Molecular weight
28.87 kDa
pI
4.92
Protein length
Gene length
function
biosynthesis of pyridoxal phosphate
product
pyridoxine, pyridoxal, and pyridoxamine kinase
essential
no
ec
2.7.4.7
synonyms
pdxK, ywdB, ipa-52r, thiD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0351

This gene is a member of the following regulons

Gene
Coordinates
3,900,963 → 3,901,778
The protein
Catalyzed reaction/ biological activity
ATP + pyridoxal --> ADP + H+ + pyridoxal 5'-phosphate (according to UniProt)
Protein family
ThiD family (with [protein|97EDB4ACD64C5FA2E6014ED133DF18F602FF58BB|thiD], according to UniProt)
Structure
[PDB|2I5B] [pubmed|16978644]
Paralogous protein(s)
[protein|97EDB4ACD64C5FA2E6014ED133DF18F602FF58BB|thiD]
Additional information
subject to Clp-dependent proteolysis upon glucose starvation [Pubmed|17981983]
Expression and Regulation
Operons
genes
[gene|FEDD589EA9982856730E809F21B7930F688FDC42|pdxK]
description
[Pubmed|3100393]
Open in new tab

[gene|FEDD589EA9982856730E809F21B7930F688FDC42|pdxK]

2021-09-30 05:19:13

Bzhu

3

a5c0884e510af0c4ecb2b2d3b03a1de3baaf44ac

DEB7C02FF379F9E98D4A5FC2B30BA5CE9C49FDB0

Biological materials
Mutant
BKE38020 (Δ[gene|FEDD589EA9982856730E809F21B7930F688FDC42|pdxK]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38020 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTCTTGAACCTCCATCA,  downstream forward: _UP4_TAAAAAAAGGGGCTGCCTTA
BKK38020 (Δ[gene|FEDD589EA9982856730E809F21B7930F688FDC42|pdxK]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38020 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTCTTGAACCTCCATCA,  downstream forward: _UP4_TAAAAAAAGGGGCTGCCTTA
References
17012797,14973012,3100393,16978644

FEDD589EA9982856730E809F21B7930F688FDC42

Page visits: 1247

Time of last update: 2021-10-19 07:02:58

Author of last update: Melvin.boenninger