SubtiWiki SubtiWiki
lutA
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

lutA
168

lactate catabolic enzyme

locus
BSU_34050
Molecular weight
26.24 kDa
pI
6.25
Protein length
Gene length
function
lactate utilization
product
lactate oxidase
essential
no
synonyms
lutA, yvfV

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0247

This gene is a member of the following regulons

Gene
Coordinates
3,494,985 → 3,495,701
Phenotypes of a mutant
no growth with lactate as the single carbon source [Pubmed|19201793]
The protein
Catalyzed reaction/ biological activity
oxidation of lactate to pyruvate [Pubmed|19201793]
Protein family
LutA/YkgE family (single member, according to UniProt)
Structure
[PDB|5ODC] (from Methanothermococcus thermoautotrophicus, 24% identity) [pubmed|28818947]
Expression and Regulation
Operons
genes
[gene|FEC83B66CEA311EA1650D61A215F82E9DF4E9F03|lutA]-[gene|57B9E37F6232189CD47C1B41FDCF43FCB8016AEB|lutB]-[gene|5EE69198882DF4E9AB8D9D7267F071EF88C2F16D|lutC]
description
[Pubmed|19201793]
regulation
induction by lactate [Pubmed|19201793]
regulatory mechanism
[protein|5A6FBAE6553343092862CB79E150F934978C32A9|sinR]: repression, [Pubmed|19201793], in [regulon|protein:5A6FBAE6553343092862CB79E150F934978C32A9|sinR regulon]
[protein|E6F3BAC5875A16D8D75B2AD21447C14DD17B3DA6|lutR]: repression, in [regulon|protein:E6F3BAC5875A16D8D75B2AD21447C14DD17B3DA6|lutR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|25031425], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|FEC83B66CEA311EA1650D61A215F82E9DF4E9F03|lutA]→[gene|5EE69198882DF4E9AB8D9D7267F071EF88C2F16D|lutC]

2021-07-08 13:35:05

ghost

3

7db2bc789fad5a99442f7b9ff99a43f2b42b4a12

59CEB598935063C72EA3D1BE77C54FD6CCE3442E

Other regulations
[protein|CE542AE1A32CCD1ABB259E6159F7A37A8078E189|fsrA]: translation repression, [Pubmed|22427629]
[protein|147AFEBEA546FDBEEB08E9A8D9C7BCDC9B83CC90|fbpB]: translation inhibition
Biological materials
Mutant
MGNA-A497 (yvfV::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/497 NBRP B. subtilis, Japan]
BKE34050 (Δ[gene|FEC83B66CEA311EA1650D61A215F82E9DF4E9F03|lutA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34050 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGATGAACCCCTCTCTCA,  downstream forward: _UP4_TAAAACTGGATTCAGAGGGG
BKK34050 (Δ[gene|FEC83B66CEA311EA1650D61A215F82E9DF4E9F03|lutA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34050 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGATGAACCCCTCTCTCA,  downstream forward: _UP4_TAAAACTGGATTCAGAGGGG
lacZ fusion
GP1612 amyE::p(lutA-lacZ cat), constructed with pGP2149 based on [wiki|pAC5], available in [wiki| Jörg Stülke]'s lab
labs
[wiki|Richard Losick], Harvard Univ., Cambridge, USA [http://www.mcb.harvard.edu/Losick/ homepage]
References
22427629,16430695,19201793,25031425,28818947

FEC83B66CEA311EA1650D61A215F82E9DF4E9F03

Page visits: 1922

Time of last update: 2021-09-17 12:30:45

Author of last update: Melvin.boenninger