SubtiWiki SubtiWiki
yitP

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yitP
168

unknown

locus
BSU_11070
Molecular weight
19.78 kDa
pI
9.92
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yitP

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
1,183,943 → 1,184,479
The protein
Paralogous protein(s)
[protein|219092C574A13B81CD312AEB55BAE48A3C541FB7|sdpA]
[wiki|Localization]
membrane (according to UniProt)
Biological materials
Mutant
MGNA-B200 (yitP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1199 NBRP B. subtilis, Japan]
BKE11070 (Δ[gene|FBA412B070CE4FFE554F2657E0F745EF5C853B8A|yitP]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE11070 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCGACTGCTCCTTTTAA,  downstream forward: _UP4_AGCATAGTCAAGGTTGTGAT
BKK11070 (Δ[gene|FBA412B070CE4FFE554F2657E0F745EF5C853B8A|yitP]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK11070 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCGACTGCTCCTTTTAA,  downstream forward: _UP4_AGCATAGTCAAGGTTGTGAT
References
27766092,31622331,17850253

FBA412B070CE4FFE554F2657E0F745EF5C853B8A

Page visits: 895

Time of last update: 2021-10-19 11:27:11

Author of last update: Jstuelk