SubtiWiki SubtiWiki
degV

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

degV
168

fatty acid binding protein

locus
BSU_35480
Molecular weight
31.43 kDa
pI
5.23
Protein length
Gene length
function
phosphorylation of fatty acids
product
fatty acid binding protein
essential
no
ec
3.6.1.1
synonyms
degV, yviA, sacU

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1307

This gene is a member of the following regulons

Gene
Coordinates
3,643,664 → 3,644,509
The protein
Catalyzed reaction/ biological activity
binds and presents fatty acids for phosphorylation to [protein|5DE73E8005AFFD30EB84696B2C2474899C6D1982|fakA] (based on findings for homologous proteins from Staphylococcus aureus) [pubmed|30429218]
[wiki|Domains]
DegV domain (aa 3-280) (according to UniProt)
Structure
[PDB|3FYS] [pubmed|19390149]
Paralogous protein(s)
[protein|C13F1870B014F8B2C16D9B169F40747DE5B51B85|yitS]
Expression and Regulation
Operons
genes
[gene|FB9ABF1FE4EC062C039A62B28A192BAA9B565EEF|degV]
description
[Pubmed|8412657]
Open in new tab

[gene|FB9ABF1FE4EC062C039A62B28A192BAA9B565EEF|degV]

2021-10-18 21:54:04

ghost

6

b8006734dba7d27a40c0b4be5602a485f310af6e

64693F93C962250609D46F4A550AEDCE5031C4C2

Biological materials
Mutant
GP3757 (Δ[gene|FB9ABF1FE4EC062C039A62B28A192BAA9B565EEF|degV]::spc), available in [wiki|Jörg Stülke]'s lab
MGNA-A387 (yviA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/387 NBRP B. subtilis, Japan]
BKE35480 (Δ[gene|FB9ABF1FE4EC062C039A62B28A192BAA9B565EEF|degV]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35480 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAGCTTCGATACCTGCCT,  downstream forward: _UP4_TAAGGCCAAATCTCCGTTTT
BKK35480 (Δ[gene|FB9ABF1FE4EC062C039A62B28A192BAA9B565EEF|degV]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35480 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAGCTTCGATACCTGCCT,  downstream forward: _UP4_TAAGGCCAAATCTCCGTTTT
Expression vectors
pGP3627 (N-terminal 6xHis-SUMO-tag, purification from E. coli, in pET-SUMO), available in [wiki|Jörg Stülke]'s lab
References
19390149,8412657,30429218

FB9ABF1FE4EC062C039A62B28A192BAA9B565EEF

Page visits: 3090

Time of last update: 2021-10-12 22:07:13

Author of last update: Dennis.wicke