SubtiWiki SubtiWiki
cdaR

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

cdaR
168

effector protein controlling [protein|AFE2A9998219162FE32E95628B3CA9071099B61A|cdaA] diadenylate cyclase activity

locus
BSU_01760
Molecular weight
52.78 kDa
pI
4.72
Protein length
Gene length
function
regulation of c-di-AMP synthesis
product
effector protein controlling [protein|AFE2A9998219162FE32E95628B3CA9071099B61A|cdaA] diadenylate cyclase activity
essential
no
synonyms
cdaR, ybbR

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG4856

This gene is a member of the following regulons

Gene
Coordinates
197,027 → 198,478
The protein
Catalyzed reaction/ biological activity
stimulates [protein|AFE2A9998219162FE32E95628B3CA9071099B61A|cdaA] activity upon protein-protein interaction [Pubmed|23192352]
[wiki|Domains]
YbbR-like 1 domain (aa 55-135) (according to UniProt)
YbbR-like 2 domain (aa 143-228) (according to UniProt)
YbbR-like 3 domain (aa 237-316) (according to UniProt)
YbbR-like 4 domain (aa 329-394) (according to UniProt)
Structure
[PDB|2KPU] (one YbbR domain, from ''Desulfitobacterium hafniense'') [Pubmed|21154411]
[wiki|Localization]
cell membrane, oriented towards the outside [Pubmed|26240071]
Expression and Regulation
Operons
genes
[gene|AFE2A9998219162FE32E95628B3CA9071099B61A|cdaA]-[gene|FB23F2AB0E2A82658009D115E5876E7AF1BDE5FD|cdaR]-[gene|F022ACB2CBB8DA46B392CE1D26474093645F26DA|glmM]-[gene|4E23D2043D51C587027ABBF6335F148295E90B8F|glmS]
description
[Pubmed|23192352]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|22211522], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|AFE2A9998219162FE32E95628B3CA9071099B61A|cdaA]→[gene|4E23D2043D51C587027ABBF6335F148295E90B8F|glmS]

2021-10-01 18:05:48

Jstuelk

11

d0e388855d436414f58a0fe3c7427dc65a267c07

DAD2D234926A5513FEB7883AAB4D651657324B25

additional information
the mRNA is very stable (> 15 min) [pubmed|12884008]
Biological materials
Mutant
GP999 (Δ[gene|FB23F2AB0E2A82658009D115E5876E7AF1BDE5FD|cdaR]::''cat''), available in [wiki|Jörg Stülke]'s lab [pubmed|23192352]
GP985 Δ[gene|AFE2A9998219162FE32E95628B3CA9071099B61A|cdaA]-[gene|FB23F2AB0E2A82658009D115E5876E7AF1BDE5FD|cdaR]::''cat''), available in [wiki|Jörg Stülke]'s lab [pubmed|23192352]
BKE01760 (Δ[gene|FB23F2AB0E2A82658009D115E5876E7AF1BDE5FD|cdaR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE01760 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACAGCCCAGCGGTTGTTTA,  downstream forward: _UP4_GAATAAAAAAGGAGCGATTA
BKK01760 (Δ[gene|FB23F2AB0E2A82658009D115E5876E7AF1BDE5FD|cdaR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK01760 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACAGCCCAGCGGTTGTTTA,  downstream forward: _UP4_GAATAAAAAAGGAGCGATTA
Expression vectors
IPTG inducible expression of Strep-''cdaR'' in ''E. coli'': pGP2565 (in [wiki|pGP172]), available in [wiki|Jörg Stülke]'s lab
IPTG inducible expression of His-''cdaR'' in ''E. coli'': pGP2557 (in [http://biochem.web.utah.edu/hill/links/pET19b.pdf pET19b]), available in [wiki|Jörg Stülke]'s lab
GP2031: ''cdaR-Strep aphA3'', chromosomal expression in B. subtilis, for [protein|search|SPINE], available in [wiki|Jörg Stülke]'s lab
two-hybrid system
B. pertussis adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]), available in [wiki|Jörg Stülke]'s lab. Respective plasmids: pGP1989 and pGP1992 [pubmed|23192352]
Antibody
available in [wiki|Jörg Stülke]'s lab
References
Reviews
25869574,30224435,32603625
Original Publications
32250026,12884008,16236721,26240071,23192352,22211522,21154411,26025048,26527648,27834680,32250026

FB23F2AB0E2A82658009D115E5876E7AF1BDE5FD

Page visits: 2691

Time of last update: 2021-10-19 10:18:39

Author of last update: Jstuelk