SubtiWiki SubtiWiki
hxlB
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

hxlB
168

6-phospho-3-hexuloisomerase

locus
BSU_03450
Molecular weight
19.82 kDa
pI
5.79
Protein length
Gene length
function
ribulose monophosphate pathway for formaldehyde fixation
product
6-phospho-3-hexuloisomerase
essential
no
ec
5.3.1.27
synonyms
hxlB, yckF

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0794

This gene is a member of the following regulons

Gene
Coordinates
374,603 → 375,160
The protein
Catalyzed reaction/ biological activity
D-arabino-hex-3-ulose 6-phosphate --> β-D-fructose 6-phosphate (according to UniProt)
Protein family
SIS family (single member, according to UniProt)
[wiki|Domains]
[wiki|SIS domain] (aa 29-172) (according to UniProt)
Structure
[PDB|1M3S] [pubmed|15363790]
Expression and Regulation
Operons
genes
[gene|BF480721B89661BFFE6632BB10C5F4DC29951784|hxlA]-[gene|FB0CEA291CA4EC5FB8410050E61B89EDBA1771F9|hxlB]
description
[Pubmed|10572115]
regulation
induction by formaldehyde ([protein|search|HxlR]) [Pubmed|10572115]
regulatory mechanism
[protein|D9A187961CFB9496A6712E9E48AAD384357A3E1C|hxlR]: activation, [Pubmed|10572115], in [regulon|protein:D9A187961CFB9496A6712E9E48AAD384357A3E1C|hxlR regulon]
Open in new tab

[gene|BF480721B89661BFFE6632BB10C5F4DC29951784|hxlA]→[gene|FB0CEA291CA4EC5FB8410050E61B89EDBA1771F9|hxlB]

2021-04-06 19:41:58

ghost

1

6c10d03b49996cafc4e7998221aed8543c838ba7

F9646F9344120B58E62D49A95B651C27C88E36F6

Biological materials
Mutant
MGNA-C056 (yckF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2054 NBRP B. subtilis, Japan]
BKE03450 (Δ[gene|FB0CEA291CA4EC5FB8410050E61B89EDBA1771F9|hxlB]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03450 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GTATTCAGTCGTTTTCATCG,  downstream forward: _UP4_TAGCATCACACAACCGGCCT
BKK03450 (Δ[gene|FB0CEA291CA4EC5FB8410050E61B89EDBA1771F9|hxlB]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03450 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GTATTCAGTCGTTTTCATCG,  downstream forward: _UP4_TAGCATCACACAACCGGCCT
References
10572115,11468398,16428816,19170879,15363790

FB0CEA291CA4EC5FB8410050E61B89EDBA1771F9

Page visits: 1480

Time of last update: 2021-08-26 16:27:44

Author of last update: Melvin.boenninger