rfaA

rfaA
168

modulator of lipid biosynthesis

locus
BSU_24330
Molecular weight
14.55 kDa
pI
4.41
Protein length
Gene length
function
control of fatty acid biosynthesis
product
modulator of lipid biosynthesis
essential
quasi
synonyms
yqhY, yqhY

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1302 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
2,529,926 → 2,530,333
Phenotypes of a mutant
the mutant readily acquires suppressor mutants that result in reduced activity of the [wiki|ACCase] [pubmed|28579978]
the mutant tends to acquire suppressor mutations that result in improved growth [Pubmed|28189581]
enhanced colony wrinkling upon knockdown [pubmed|36069446]
the mutant forms lipophilic clusters [pubmed|28579978]
severe growth inhibition upon addition of subinhibitory concentrations of mirubactin C [pubmed|36312962]
The protein
Protein family
asp23 family (with [protein|2AD4F0AA218D4B8864E43A3E501A5B7EFC6256FE|yloU], according to UniProt)
Structure
[AF|P54519]
Paralogous protein(s)
[protein|2AD4F0AA218D4B8864E43A3E501A5B7EFC6256FE|yloU]
[wiki|Localization]
cell poles [pubmed|28579978]
Expression and Regulation
Operons
genes
[gene|ADD1CE87C1C5BA44FFF5499EA5E155C4C53A1C22|accB]-[gene|1DFFEB155028A5C6B4B344769EF7DAAC14983322|accC]-[gene|FACE7176B1A1F354CF27FB30E46A1140FAFB02F0|rfaA ]
description
[Pubmed|7592499]
Open in new tab

[gene|ADD1CE87C1C5BA44FFF5499EA5E155C4C53A1C22|accB]→[gene|FACE7176B1A1F354CF27FB30E46A1140FAFB02F0|rfaA ]

2024-02-23 13:58:34

ghost

111

86e257ca959326e8b837637c9b51bc6f18c4c8c4

C4E0BC3C47DE59CA027C5A57E3491771B42AECD9

Biological materials
Mutant
MGNA-C367 (yqhY::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2365 NBRP B. subtilis, Japan]
GP1468 (Δ''yqhY''::''erm''), available in [wiki|Jörg Stülke]'s lab [pubmed|28579978]
GP1765 (Δ''yqhY''::''cat''), available in [wiki|Jörg Stülke]'s lab [pubmed|28579978]
BKE24330 (Δ[gene|FACE7176B1A1F354CF27FB30E46A1140FAFB02F0|rfaA ]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE24330 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCAATTCACCTCCGTAA,  downstream forward: _UP4_TAAATGGCTTAACACGAAAC
BKK24330 (Δ[gene|FACE7176B1A1F354CF27FB30E46A1140FAFB02F0|rfaA ]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK24330 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCAATTCACCTCCGTAA,  downstream forward: _UP4_TAAATGGCTTAACACGAAAC
Expression vectors
GP1474 (chromosomal ''yqhY''-Strep fusion, ''aphA''3), purification from ''B. subtilis'', for [wiki|SPINE], available in [wiki|Jörg Stülke]'s lab
pGP1322 (N-terminal Strep-tag, purification from ''E. coli'', in [wiki|pGP172]), available in [wiki|Jörg Stülke]'s lab
pGP1325 (N-terminal His-tag, purification from ''E. coli'', in [wiki|pWH844]), available in [wiki|Jörg Stülke]'s lab
pGP1496 (His-tag, purification from ''E. coli'', in pET28a+), available in [wiki|Jörg Stülke]'s lab
pGP1498 (N-terminal His-tag, TEV-site, purification from ''E. coli'', in [wiki|pWH844]), available in [wiki|Jörg Stülke]'s lab
pGP3619 expression of [gene|FACE7176B1A1F354CF27FB30E46A1140FAFB02F0|rfaA ]-Strep by [wiki|pGP382] in B. subtilis suitable for [wiki|SPINE], available in [wiki|Jörg Stülke]'s lab
pGP3630 (N-terminal 6xHis-SUMO-tag, purification from E. coli, in pET-SUMO), available in [wiki|Jörg Stülke]'s lab
pGP3644 (N-terminal GST-Tag, purification from ''E. coli'', in [wiki|pGEX-6P-1]), available in [wiki|Jörg Stülke]'s lab
two-hybrid system
''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]), available in [wiki|Jörg Stülke]'s lab
FLAG-tag construct
GP1481 (spc, based on [wiki|pGP1331]), available in [wiki|Jörg Stülke]'s lab
GFP fusion
GP1471 (spc, based on [wiki|pBP43]), available in [wiki|Jörg Stülke]'s lab [pubmed|28579978]
References
Reviews
36882621
Original Publications
17114254,7592499,23420519,24178028,28579978,36069446,36312962

FACE7176B1A1F354CF27FB30E46A1140FAFB02F0

Page visits: 4838

Time of last update: 2024-02-24 07:55:23

Author of last update: Jstuelk