SubtiWiki SubtiWiki
bacG
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

bacG
168

short chain reductase involved in bacilysin synthesis

locus
BSU_37680
Molecular weight
27.87 kDa
pI
6.6
Protein length
Gene length
function
biosynthesis of the antibiotic bacilysin
product
short chain reductase
essential
no
synonyms
bacG, ipa-86r, ywfH

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1028

This gene is a member of the following regulons

Gene
Coordinates
3,867,493 → 3,868,272
The protein
Catalyzed reaction/ biological activity
BacG catalyzes the conjugate addition of hydride at the C4 olefinic terminus using NADH to yield the cyclohexenol- containing tetrahydro-4-hydroxyphenylpyruvate [Pubmed|20052993]
stereoselective reduction of dihydro-hydroxyphenylpyruvate (H2HPP) to tetrahydro-hydroxyphenylpyruvate (H4HPP), NADPH-dependent reductase that facilitates the conjugate addition of a hydride at the C(4) olefin terminus of H2HPP [Pubmed|23519407]
Protein family
[wiki|Short-chain dehydrogenases/reductases (SDR) family] (according to UniProt)
[wiki|Cofactors]
NADPH [Pubmed|23519407]
Structure
[PDB|3U49] [Pubmed|23519407]
Expression and Regulation
Operons
genes
[gene|F8FF994BF2FDFB27DE63C1F8FB75DAB7E90FC78C|bacG]
description
[Pubmed|12372825]
regulation
repressed by casamino acids [Pubmed|12107147]
regulatory mechanism
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [Pubmed|12372825], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
Open in new tab

[gene|F8FF994BF2FDFB27DE63C1F8FB75DAB7E90FC78C|bacG]

2021-08-08 03:51:06

ghost

4

25c148014fadf87dc8230d25050c765698853a8e

F1A5D3A777C41135EC339ED562DB033947D195F0

Biological materials
Mutant
MGNA-A515 (ywfH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/515 NBRP B. subtilis, Japan]
BKE37680 (Δ[gene|F8FF994BF2FDFB27DE63C1F8FB75DAB7E90FC78C|bacG]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37680 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAATAACTGCACCCCTTTG,  downstream forward: _UP4_AGCATATAAAAACATCCCGC
BKK37680 (Δ[gene|F8FF994BF2FDFB27DE63C1F8FB75DAB7E90FC78C|bacG]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37680 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAATAACTGCACCCCTTTG,  downstream forward: _UP4_AGCATATAAAAACATCCCGC
References
12372825,12107147,20052993,21948839,23519407

F8FF994BF2FDFB27DE63C1F8FB75DAB7E90FC78C

Page visits: 1854

Time of last update: 2021-08-29 11:36:46

Author of last update: Jstuelk