SubtiWiki SubtiWiki
yqeU
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yqeU
168

ribosomal RNA small subunit methyltransferase E

locus
BSU_25440
Molecular weight
28.65 kDa
pI
5.29
Protein length
Gene length
function
rRNA maturation
product
ribosomal RNA small subunit methyltransferase E
essential
no
synonyms
yqeU, rsmE

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1385

This gene is a member of the following regulons

Gene
Coordinates
2,623,032 → 2,623,802
The protein
Catalyzed reaction/ biological activity
S-adenosyl-L-methionine + uridine1498 in 16S rRNA --> H+ + N3-methyluridine1498 in 16S rRNA + S-adenosyl-L-homocysteine (according to UniProt)
Protein family
RNA methyltransferase rsmE family (single member, according to UniProt)
Structure
[PDB|1VHK] [pubmed|16021622]
Expression and Regulation
Operons
genes
[gene|2E57DFB4162EF0CE759C1FC42C637E1B9E4B2F7E|hrcA]-[gene|ECAB685E9038DC03FA2CC659112BB07D30DE5C8C|grpE]-[gene|30E0AAABB803E577D0D9FBAEF9031319CABD3D89|dnaK]-[gene|D4C75B39B2DAECB9D85DAD66AAD4F923C9AEBEA7|dnaJ]-[gene|70D717806F5174447E01FF33DC8299CB025888CD|yqeT]-[gene|F8DC71B29D9C9BF4CF5124D0F01A71548306B9F9|yqeU]-[gene|6ADA5AF308D96218414EA92DFF4A57BAEAD0554B|yqeV]
description
[Pubmed|9023197]
regulation
induced by heat shock ([protein|search|HrcA]) [Pubmed|1339421]
regulatory mechanism
[protein|2E57DFB4162EF0CE759C1FC42C637E1B9E4B2F7E|hrcA]: repression, [Pubmed|1339421], in [regulon|protein:2E57DFB4162EF0CE759C1FC42C637E1B9E4B2F7E|hrcA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|1339421], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|2E57DFB4162EF0CE759C1FC42C637E1B9E4B2F7E|hrcA]→[gene|6ADA5AF308D96218414EA92DFF4A57BAEAD0554B|yqeV]

2021-09-08 23:57:14

ghost

10

5537cbdd2a5f5134768e8ba4f02922d86d6e912b

1FEFD4DF6108A61DA84FEA3CD39009FF4CA3EC3B

additional information
the mRNA is cleaved by [protein|BAB297D18F94FFA67B8D12A684AB4D1BCDFB4981|RNase III] [PubMed|26883633]
Biological materials
Mutant
MGNA-C497 (yqeU::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2495 NBRP B. subtilis, Japan]
BKE25440 (Δ[gene|F8DC71B29D9C9BF4CF5124D0F01A71548306B9F9|yqeU]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25440 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATACGCTGTGACACCTACT,  downstream forward: _UP4_GAGTTATTAAGAGGTGATCA
BKK25440 (Δ[gene|F8DC71B29D9C9BF4CF5124D0F01A71548306B9F9|yqeU]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25440 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATACGCTGTGACACCTACT,  downstream forward: _UP4_GAGTTATTAAGAGGTGATCA
References
10383760,9023197,7592421,16021622,26883633

F8DC71B29D9C9BF4CF5124D0F01A71548306B9F9

Page visits: 1370

Time of last update: 2021-09-18 21:03:44

Author of last update: Melvin.boenninger